Answer the following questions:
1. How does motion help us in our daily life?
2. How would you be able to help those people who cannot move due to
paralysis​

Answers

Answer 1

Answer:

1. Lack of motion is death. Movement is a vital nutrient to your body, just as much as food, water, and oxygen.

2. Potassium supplements can prevent attacks of paralysis.

Explanation:


Related Questions

Can viruses live through mutation and natural selection

Answers

Answer:

sure why not

Explanation:

as the virus mutates, it may increase, or lessen the chance for the virus to survive a battle against its host. like your regular living organisms (though keep in mind viruses are not considered living), some survive and some die due to natural selection and mutation.

I am pretty sure that the answer is yes since viruses have been around for a long time :))

Action Potential: Relative refractory period
In a neuron, there is a period of time called the absolute refractory period where it is impossible for an action potential to
begin. This corresponds to the change in membrane potential from +30 to -70 mV, or the repolarization phase. Towards the
end of the repolarizing phase, there is a relative refractory period where it is difficult, but not impossible, for another action
potential to begin. Using the time slider function, which of the following segments in the neuron would correspond to a
relative refractory period?

Answers

A second action potential can be triggered during the relative refractory phase, but it will need a stronger stimulus to do so than the first time. Refractory times are brought on by the inactivation gate of the Na+ channel.

What Action Potential related to Relative refractory period?

The axon has a tougher time producing successive action potentials during this time period, which is referred to as the refractory period, as a result of these transient alterations.

As a result, the refractory period restricts the quantity of action potentials that a certain nerve cell can generate in a given amount of action potentials time.

If enough powerful stimuli are applied to the neuron after the absolute refractory time, Na+ channels start to recover from inactivation and the neuron may respond once again by generating action potentials.

Therefore, A stimulus that is stronger than usual is required to generate neuronal activation during the relative refractory period.

Learn more about Action Potential here:

https://brainly.com/question/7277845

#SPJ6

Seeds inside the closed vessel does not give new seeding ,why?​

Answers

Answer:

It is not able to produce a new seedling as it requires sunlight and air to prepare its own food and the process of photosynthesis does not occur. So, the seed inside the closed vessel does not give new seedling.

Explanation:

Answer:

It is not able to produce a new seedling because it needs the sun and air to prepare it's own food and the process of photosynthesis does not occurs

Explanation:

Details are underlated or irrelevant details to the topic at hand

Answers

extraneous!!!!!!!! no cap

. Students decide to remove the litter from an abandoned park and plant trees. Which of the following observations provides the best evidence that the action of the students has had a positive effect on the health of the park ecosystem?
A. The number of human visitors decreases.
B.The level of yearly precipitation increases.
C.The number and diversity of animals increases.
D.The average daily high temperature decreases.

Answers

Answer:

c

Explanation:

HELP! whoever does these gets brainliest!!

Answers

Answer:

blood crime scene arson murder footprint

Need help with this will make brainliest if right
Research on the different thermal conductivities of different materials. From the different values of the thermal conductivities give seven example of conductors and seven example of insulators

Answers

Answer:

conductors are like silver, gold, copper, steel, sea water, and iron. insulators are rubber, glass, oil, diamond, dry wood, and insulation.

Explanation:

What needs to happen in order for two populations to be isolated?

Answers

Answer:

Isolation means that organisms of the same species are separated, and happens when there is something between the organisms that they can't cross.

Explanation:

Organisms become isolated as a result of environmental change. The cause of isolation can be gradual, like when mountains or deserts form, or continents split apart.

Describe the 6 phases of developing a vaccine

Answers

Answer:

Exploratory stage

Pre-clinical stage

Clinical development

Regulatory review and approval

Manufacturing

Quality control

Explanation:

Internet

Explanation:

there are many stages to a vaccine

many come from ... developing symptoms

in which some case can come from

some quality control, pre-clinical control or even exploratory stage

a plane mirror is useful for seeing

Answers

Oh.... very nice! Yes seeing is nice

What is a pill bugs habitat

Answers

Answer:

The pillbug's main habitat is under mulch, fallen leaves, and rocks. Pillbugs are nocturnal and require humid conditions during the day. Pillbugs are generally found in soil with sowbugs, millipedes, and earthworms. Their preferred soil habitat is composed of organic matter and has a neutral to alkaline pH.

What are the "energy factories" within a plant cell?

Answers

mitochondria is the energy factors in a plant cell! hope this helps

The Venn diagram provided compares and contrasts two domains of living things. Both domains include species of
bacteria. Select ALL of the terms which could be applied to only group A in the diagram.
A)
ancient
B)
unicellular
may be pathogenic
D)
live everywhere in the environment
E)
cell wall is made of peptidoglycan

Answers

Answer:

C,D,E

Explanation:

i just did it and got them right.Hope this helps :}

This group of Bacteria can be pathogenic, ubiquitous in the environment whose cell walls are composed of peptidoglycan. So, the correct options are C, D and E.

What is Bacteria?

Bacteria are defined as ubiquitous, mostly free-living organisms that contain a single biological cell that constitute a large domain of prokaryotic microorganisms. Bacteria are a few micrometers in length that were among the first life forms to appear on Earth, and are present in most of its habitats.

Some bacteria are harmful that serve a useful purpose that support many forms of life, both plant and animal, and are used in industrial and medicinal processes. This group A mentioned in the above example of Bacteria can be pathogenic, ubiquitous in the environment whose cell walls are composed of peptidoglycan.

So, the correct options are C, D and E.

Learn more about Bacteria, here:

https://brainly.com/question/8008968

#SPJ5

In 1847, the German biologist Christian Bergmann noted that mammals and birds living at higher latitudes (farther from the equator) are on average larger and bulkier than related species found at lower latitudes. Suggest an evolutionary hypothesis to explain this observation.

Answers

Answer:

not quite sure how to do the hypothesis but its likely to be something to do with the fact that they need more fat and muscle due to the thinner atmosphere as respiration is harder to occur.

Explanation:

Kudzu, a plant native to eastern Asia was introduced into America in 1876. In 1935, Kudzu was planted along southern roadways to control soil erosion. Adding a foot of vine a day in the spring and summer

kudzu quidity grew out of control. Why can introducing a new species to an existing ecosystem often be a disaster?

A The new species can create excess nutrients in the soil that can damage native species

The series can harminative anime and damage the ecosystem

Answers

Answer:

Due to lack of biological gent.

Explanation:

Introducing a new species to a new ecosystem often leads to a disaster because of the absence of bioagent for that species. Bioagent are those organisms which has the ability to control other organisms by feeding on them. A new species does not make problem in its old or original ecosystem due to the presence of controlling agents but in the new ecosystem there is no bioagent that can stop its growth so that's why sometimes the introduction of new species leads to a disaster.

An individual with two different alleles for the same gene is
called

Answers

Answer:

an individual with two same alleles genes is called a heterozygous

Why is it important for nitrogen to be more abundant in our atmosphere than oxygen?
A. Oxygen is only breathable if diluted with nitrogen.

B. Nitrogen and oxygen combine to produce weather that is essential for life.

C. Oxygen must be diluted because it is a highly combustible gas.

D. Nitrogen is a heavy molecule that pulls oxygen, a light molecule, to the surface for oxygen-dependent life to use.
(also report this idiot called americanlove if spot him, for the last 2 hours he has been going to almost every post just to steal points for no reason)

Answers

Answer:

Choice C

Oxygen must be diluted because it is a highly combustible gas.

Oxygen must be diluted because it is a highly combustible gas is important for nitrogen to be more abundant in our atmosphere than oxygen.

Why nitrogen is important?

Nitrogen is extremely important to living material. Plants, animals and humans could not live without it.

The major source of nitrogen is the atmosphere. It exists as a colorless, odorless, nontoxic gas and makes up about 78 percent of the atmosphere. Nitrogen is also found in the Earth's crust as part of organic matter and humus.

Our atmosphere's nitrogen gas is a molecule made up of two nitrogen atoms. This kind of nitrogen can't be utilized by plants directly. Before it can be utilized by plants, nitrogen needs to be transformed into other forms.

Therefore, Oxygen must be diluted because it is a highly combustible gas is important for nitrogen to be more abundant in our atmosphere than oxygen.

To learn more about Nitrogen, refer to the link:

https://brainly.com/question/19938608

#SPJ2

How is the food you choose to eat used to create energy? referring to cellular respiration

Answers

Answer:

Through the process of cellular respiration, the energy in food is converted into energy that can be used by the body's cells. During cellular respiration, glucose and oxygen are converted into carbon dioxide and water, and the energy is transferred to ATP.

Please help!!!! 20 points

Answers

Answer:

Producers: Leaves and the other plant thing (i don't know the name of it)

First-level consumers: Squirrel, grasshopper, rabbit, rat

Second-level consumers: Frog, rat

Third-level consumers: Fox, owl, snake

Herbivores: Grasshopper, rabbit, squirrel

Carnivores: Frog, fox, snake, owl

Omnivores: Rat

A rock is an (blank) of minerals.

Answers

A rock is an aggregate of minerals

GIVING BRAINLIEST ANSWER CORRECTLY FOR 40 POINTS
List 3 people from the history of biotechnology and write one sentence about each persons contribution​

Answers

Answer:

Karl Ereky

Explanation:

He discovered it

A striped billiard ball rolls and strikes a motionless solid billiard ball. The solid ball then begins to roll.

Which best describes the change in the magnitudes of momentum for the balls?
The change is greatest for the solid ball.
The change is greatest for the striped ball.
The change is the same for each ball.
The change depends on the direction each ball rolls.

Answers

Answer:

The change is greatest for the solid ball

Flowering plants and pollinators, such as bees, have adapted together over time in ways that enhance each other's survival. The bee obtains nectar from the flower How does the flower benefit from this relationship?
O It gains food
O
It is pollinated
O Its seeds are dispersed.
It receives growth hormones

HELP PLEASE!!!

Answers

Answer:

it is pollinated

............

Answer: it’s pollinated

Explanation:

i took the test lol

A lamprey eel fastens itself to a host fish, such as a lake perch, and feeds on it. When the fish dies, the lamprey finds another host. Which type of symbiosis is this?​

Answers

The relationship between the two is harmful and parasitic

Which three organ systems work together to take in oxygen and other
nutrients and deliver them to an animal's body cells?
A. Respiratory, because it takes in gases from the external
environment
B. Circulatory, because blood absorbs nutrients and carries them to
other cells
c. Nervous, because it controls the body functions and responses to
stimuli
D. Digestive, because it breaks down the nutrients in food into
substances that can be used by cells

Answers

Answer:A, B and D

Explanation:Respiratory takes in oxygen and digestive absorbs nutrients from the food while the circulatory deliver those through the entire body.

A B D im on the exam

What is structure 1?

Answers

Answer:

Bro give a chart or something not just a question with no info.

Explanation:

The typical human adult uses about 160 g of glucose per day, 120 g of which is used by the brain. The available reserve of glucose (~20 g of circulating glucose and ~190 g of glycogen) is adequate for about one day. After the reserve has been depleted during starvation, what other sources can be used to produce glucose

Answers

Answer:

Fats and proteins that are present in liver, kidneys, and muscles.

Explanation:

When the reserve of glucose is used by the body during starvation, our body uses fats and proteins that are present in liver, kidneys, muscles etc and convert these fats and proteins into glucose. There is high amount of fats and proteins present in our body which can be used when the glucose reserves depleted from the body during starvation so we can conclude that the fats and proteins are the sources that can be used to produce glucose for the body.

In the fantastic Jillalope, the offspring of a true-breeding black parent and a true-breeding white parent all appear gray. When these gray offspring are crossed among themselves, their offspring always appear in a ratio of 1 black : 2 gray : 1 white. Upon close examination of the coats with a magnifier, each hair of a gray animal has closely-spaced alternating black spots and white spots, but no gray spots. What is the mode of inheritance

Answers

Answer:

Co-dominance

Explanation:

Due to technical problems, you will find the  complete explanation in the attached files

YALL PLEASE HELP 90 points ;(

Answers

Answer:

it is too small so i can't see it

Answer: Could you make it bigger because I don't have my glasses. Thx and will answer when problem is solved.

Explanation:

After a fire in a Florida pine forest, new growth occurs. Which process allows this to happen?
A succession
B
competition
С
predation
D
symbiosis

Answers

Answer:A) succession

Explanation:

Other Questions
EnglishFlowers for Algernon question How is an IQ defined by the various characters (April 21)? which part in a mosque might be blocked 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA HURRY I NEED HELPP!! of sales tax is 6%, what is the final price of a Microwave oven whose list price is $110.00? What is the probability that Mary will get an "11"? Please help TIA!!!!!!!! What is the value of the expression: 2/10 5/4?1/504/108/501/2 Raymond needs to cover the entire surface area of the square based pyramid with paper what is the minimum amount of paper he will need What two numbers have a sum of 215 and a difference of 137 work out 56 - 8 2 what is the order from least to greatest(38%,3/8,0.4,1/3,41%,0.33) John ate three hot dogs at a hot dog eating contest in 45 seconds. How many hot dogsshould he be able to eat in the 5 minute contest limit? show work Using the figure, angels p and w are example of Answer :) Hellohello, if you able to help me then please do. (: What is the volume of a hemisphere with a diameter of 37.6 m, rounded to the nearest tenth of a cubic meter? Describe the process of cloning from start to finish. Carol Beal is the export manager at Gudrun Sjoden USA, a licensed distributor for a Swedish designer. Carol has North America and all of Asia in her territory. She has just formed a joint venture to run retail branches in Tokyo, Shanghai, and Seoul. Her plan is to ship directly from the Gudrun Sjoden warehouse in Stockholm. Her Asian partner has requested she ship to her DDP, but Carol would prefer to ship Ex Works. Carol knows that there are critical differences between the two terms of sale and is reviewing what decision to make. She wants to keep her U.S. expenses as low as possible, and she would be funding the shipping out of the United States. She also wants to continue to build a good, solid, trusting relationship with her joint venture partner.Which statement is true Carol ships goods Ex Works? a. The buyer would cover shipping and insurance costs assume the risk the door. b. The seller would cover all insurance costs while the buyer would cover the cost of shipping. c. The goods be shipped from Stockholm at the seller's expense. d. The seller would cover all shipping and insurance costs and assume the risk at the factory door. e. The buyer would cover all insurance costs while the seller would cover the cost of shipping 2.95___2.949 which is greater I need help what's the answer anyone? Steam Workshop Downloader