ce a vrut să spună Moș Nicolae în propoziția aceasta:
Pentru o faptă bună ne așteaptă răsplată

Answers

Answer 1
Atunci când faci o fapta buna o Primești inapoi atunci când ai nevoie când știe Dumnezeu ca atunci ai nevoie nu cand vrei ti

Related Questions

They were _________ to pay the rent, and were evicted from their home.

Answers

Answer:

they were about to pay the rent and were evicted from their home

Explanation:

sorry if it wrong

Answer:

they were about to pay the rent and were evicted from their home

Explanation:

how do you say please write me back in french

Answers

Answer:

s'il vous plaît, écrivez-moi bientôt

s’il vous plaît écrivez moi

PLS PLS PLS write a paragraph that describes how people resisted enslavement and why their actions were important.

My brain went blank

Answers

ʀᴜɴɴɪɴɢ ᴀᴡᴀʏ ᴡᴀꜱ ᴏɴᴇ-ᴡᴀʏ ᴇɴꜱʟᴀᴠᴇᴅ ᴘᴇᴏᴘʟᴇ ʀᴇꜱɪꜱᴛᴇᴅ ʙᴇɪɴɢ ᴇɴꜱʟᴀᴠᴇᴅ. ᴘᴇᴏᴘʟᴇ ʀᴀɴ ᴀᴡᴀʏ ꜰᴏʀ ʀᴇᴀꜱᴏɴꜱ ᴍᴏʀᴇ ᴛʜᴀɴ ᴇꜱᴄᴀᴘɪɴɢ. ɪᴛ ᴡᴀꜱ ꜱᴏᴍᴇᴛɪᴍᴇꜱ ᴛᴏ ᴍᴇᴇᴛ ᴡɪᴛʜ ꜰʀɪᴇɴᴅꜱ ᴀɴᴅ ꜰᴀᴍɪʟʏ ꜱɪɴᴄᴇ ᴇɴꜱʟᴀᴠᴇᴅ ꜰᴀᴍɪʟɪᴇꜱ ᴡᴇʀᴇɴ'ᴛ ᴋᴇᴘᴛ ᴛᴏɢᴇᴛʜᴇʀ. ꜱʟᴀᴠᴇꜱ ᴡᴇʀᴇ ᴀʟꜱᴏ ᴛɪʀᴇᴅ, ᴍᴇɴᴛᴀʟʟʏ ᴀɴᴅ ᴘʜʏꜱɪᴄᴀʟʟʏ, ꜱᴏ ᴛʜᴇʏ ꜱʟᴏᴡᴇᴅ ᴅᴏᴡɴ ᴛʜᴇ ᴡᴏʀᴋ. ᴛʜᴇʏ ʙʀᴏᴋᴇ ᴛᴏᴏʟꜱ ᴛʜᴀᴛ ᴛʜᴇʏ ʜᴀᴅ ᴛᴏ ᴜꜱᴇ ᴛᴏ ᴡᴏʀᴋ, ꜱᴇᴛ ᴛʜɪɴɢꜱ ᴏɴ ꜰɪʀᴇ, ᴘʟᴀʏᴇᴅ ᴅᴜᴍʙ, ᴀɴᴅ ᴘʀᴇᴛᴇɴᴅᴇᴅ ᴛᴏ ʙᴇ ꜱɪᴄᴋ. ᴡᴏᴍᴇɴ ᴇᴠᴇɴ ᴜꜱᴇᴅ ᴛʜᴇɪʀ ʙᴏᴅɪᴇꜱ ᴛᴏ ᴀᴠᴏɪᴅ ᴡᴏʀᴋɪɴɢ.

(Had to use a font bc brainly said it was "inappropriate")

What is the purpose of a poem that depends completely on images?
to show readers what would happen if we just thought in images
to make sure that readers don't think of anything else
to prevent readers from thinking about ideas
to help readers see something in a new and different way

Answers

[tex]\large\huge\green{\sf{Answer:-}}[/tex]

to help readers see something in a new and different way

Answer:To help readers see something in a new and different way

Explanation:

Hope this helps!


Read the following passage from "The Setting Sun and the Rolling World."
He himself had taken chances before, in his own time, but he felt too much of a father. He had worked and slaved for his family and the land had
not betrayed him. He saw nothing now but disaster and death for his son out there in the world. Lions had long since vanished but he knew of
worse animals of prey...
What does the land likely represent to Old Musconi?
O A security, protection, family
B. opportunity, risk, reward
C. frustration, disappointment, children
D. suffering, loneliness, betrayal

Answers

Answer:

suffering, loneliness, betrayal

Explanation:

This is because he was betrayed and he was lonely and he was suffering and now can see darkness more then anything in his life....

THIS IS EMOTIONAL....

Задание 1. Прочитайте текст, выполните задания. (8 баллов)
Человек и ландшафт - два живых организма. Под воздействием тех или иных ландшафтов меняется физическое состояние человека.
Рассмотрим несколько видов ландшафтов.
Лесные ландшафты. Леса, прежде всего, несут энергию силы, мудрости, охраны и стойкости. Те личности, которым изначально свойственны эти качества, обычно любят лес и чувствуют себя в нем как дома. Лес - защита, преграда на пути невзгод и негативных энергий. Причем темный лес - это глухая стена, закрытие от мира, уход во внутреннее пространство. Светлый лес как бы задерживает негативные энергии и пропускает позитивные.
Равнинные ландшафты. Равнины связаны с тишиной, ясностью сознания, открытостью внешнему миру. Замкнутые, суетливые люди, как правило, избегают открытых пространств, которые рождают у них чувство незащищенности.
Степь. Энергетика степи, в большей степени, чем, пожалуй, у других ландшафтов, зависит от времени года. Наиболее ярко она раскрывается весной и летом. Степь с цветами несет радость, полноту бытия, состояние полной открытости миру, счастья и безмятежности.
Ландшафт влияет не только на политические и экономические аспекты: он также формирует характер и личностные качества людей, живущих в данной местности.

Выполните следующие задания:
1. Озаглавьте текст. (1 б.)
2. Разделите текст на смысловые части, составьте план. (2 б.)
3. Выпишите из текста предложение, отражающее его основную мысль. (2 б.)
Ответьте на вопрос:
В какой части текста (вступление, основная часть, заключение) находится это предложение? Почему? Ответ аргументируйте. (3 б.)

Answers

Answer:

Assignment 1. Read the text, complete the assignments. (8 points)

Man and landscape are two living organisms. Under the influence of certain landscapes, the physical state of a person changes.

Let's consider several types of landscapes.

Forest landscapes. Forests, above all, carry the energy of strength, wisdom, protection and resilience. Those individuals who initially have these qualities usually love the forest and feel at home in it. The forest is a protection, an obstacle on the way of adversity and negative energies. Moreover, a dark forest is a blank wall, a closure from the world, a withdrawal into the inner space. The light forest, as it were, traps negative energies and lets positive ones pass.

Plain landscapes. Plains are associated with silence, clarity of consciousness, openness to the outside world. Introverted, fussy people tend to avoid open spaces, which make them feel insecure.

Steppe. The energy of the steppe, to a greater extent than, perhaps, in other landscapes, depends on the season. It reveals itself most vividly in spring and summer. A steppe with flowers brings joy, fullness of being, a state of complete openness to the world, happiness and serenity.

The landscape influences not only the political and economic aspects: it also shapes the character and personality of the people living in a given area.

Complete the following tasks:

1. Title the text. (1 b.)

2. Divide the text into semantic parts, make a plan. (2 b.)

3. Write out a sentence from the text that reflects its main idea. (2 b.)

Answer the question:

In what part of the text (introduction, main part, conclusion) is this sentence? Why? Argument your answer. (3 p.)

Explanation:

what is unusual about the women in the snow story?

Answers

Answer:

her inhumanly pale or even transparent skin makes her blend into the snowy landscape

Why do we group countries by regions?

Answers

Answer:

Regional integration helps countries overcome divisions that impede the flow of goods, services, capital, people and ideas. These divisions are a constraint to economic growth, especially in developing countries.

Explanation:

Hope this helps!

Fill in the blank with a suitable ARTLCLE
1. What.....nice view!
2. He doesn't like listening to ... music but he often watches... television. He never listens to... radio.​

Answers

Answer:

Hello There!

Hope this helped! I myself don't know if this is right but i like helping....

Explanation:

1- What a nice view!

2-He doesn't like listening to the music but he often watches the television. He never listens to the radio.

I need help can someone help

Answers

I’m srry I really dont understand

Translate this in Korean Please...

"Thank you for everything and Hope you are doing good with your new family"

Answers

"모든 것에 감사하고 새 가족과 좋은 일 하기를 바랍니다"

Answer: 모든 것에 감사하고 새 가족과 함께 좋은 일을 하기를 바랍니다 or modeun geos-e gamsahago sae gajoggwa hamkke joh-eun il-eul hagileul balabnida

Explanation:

Question 1(Multiple Choice Worth 4 points)
(01.01 MC)
Which of the following was a result of the protests at Gallaudet University?
OI. King Jordan became the first Deaf president of Gallaudet University, replacing a hearing president.
Alexander Graham Bell led the charge against signing in schools.
The football huddle was invented by Gallaudet University.
The Library of Congress inducted the Preservation of the Sign Language into its film registry.
PLEASE HELP

Answers

Answer:

oye cres que me puedas ayuda con un ejercicio???

Explanation:

porfa es que ten examen en el cole y no tengo ninguna alluda

choose the correct answer for the given statement :

Relationship of TR and MR in perfect competition

(i) TR > MR
(ii) TR = MR
(iii) TR < MR
(iv) None of the above ​

Answers

Answer:

(ii) TR = MR

Explanation :

TR = MR in perfect competition beacuse the firm was price-taker.

parts of a typhoon

use the words in the box below to label the parts of a typhoon​

Answers

there are only one word "hurricanes" where are the other words in the box please?

Pasagot po please.

Paano nakatutulong ang kamalayan sa wika sa pagkabuo ng kultura?

Answers

Answer:

no i'm so sorry to hear that i but  i can't really understand you sorry L

Explanation:

Due to animal rescue efforts, sea turtles have made a comeback and are no longer on the endangered list.

What does comeback mean? (1 point)

A cause for complaint
A doubt about the truth
A question of placement
A return to a former state

Answers

A return to a former state.

This is because turtles were once endangered but are no longer.

Who was Albert Einstein?
byee ​

Answers

Answer:

Albert Einstein was one of the fathers of modern science as well as a human rights enthusiast.

Explanation:

Hi!Albert Einstein was a German-born theoretical physicist, widely acknowledged to be one of the greatest and most influential physicists of all time. Einstein is best known for developing the theory of relativity, but he also made important contributions to the development of the theory of quantum mechanics.

imamade ichido mo onnaatsukai sareta koto ga nai onna kishi wo onnaatsukai suru

Answers

Answer: What has been treated as a woman even once treats the inner female knight as a woman

Explanation:

did Yuzuru Hanyu overcome any adversities as a child if so what was it​

Answers

Answer:

If your talking about the Figure Skater he has Asthma so i'd assume it made him face some hardships in his childhood, even now he stops to catch his breath a lot

Explanation:

amyendahan kasingkahulugan

Answers

Answer:

Magkatulad na salita

baguhin

pandiwa

rebisahin

baguhin

pagbabago

baguhin

maging kuwalipikado

umangkop

ayusin

i-edit

copyedit

muling isulat

rescript

muling burador

recast

muling parirala

muling salita

muling gawain

reporma

Explanation:

ow has Elon Musk and his company, SpaceX, changed the way spaceships fly?

Answers

Spacex have made many accomplishments such as

First privately funded fully liquid-fueled rocket to reach orbit. First privately developed liquid-fueled rocket to put a commercial satellite in orbit. First private company to successfully launch, orbit, and recover a spacecraft. First private company to send a spacecraft to the International Space Station (ISS).

Hope this helps!
Brainliest and a like is much appreciated!

4. When a poet uses a metaphor in a poem, what is he or she saying?
That something is a little bit like something else.
That something is so different from anything else that it's unique.
That two things are really different and have little in common.
That one thing is so much like another that it IS that other thing.

Answers

[tex]\huge{\underline{\underline{\boxed{\sf{\purple{ǫᴜᴇsᴛɪᴏɴ}}}}}}[/tex]

When a poet uses a metaphor in a poem, what is he or she saying?That something is a little bit like something else.That something is so different from anything else that it's unique.That two things are really different and have little in common.That one thing is so much like another that it IS that other thing.

[tex]\large\huge\green{\sf{ANSWER:-}}[/tex]

➡(2). That something is so different from anything else that its unique.

[tex]\large\huge\green{\sf{Explaination:-}}[/tex]

➡A metaphor is a figure of speech in which a word or phrase is applied to an object or action to which it is not literally applicable. So 2) is just the only one that makes sense.

Answer: That one thing is so much like another that it IS that other thing

Explanation:

i put it in and it was right

3.Choose the best one (A, B, C or D) to complete the sentence or replace the underlined word.

Bach Ma National Park close to the sea.
(2.5 Điểm)
A. is located
B. is being located
C. locates
D. located

Answers

the answer should be A

how far would your friend run in 30 minutes?

Answers

Answer:

a mile or 2 she not a fast runner

Answer:about 3 Miles because he runs pretty fast

Explanation:

Which order is correct when signing the sentence "I have 2 sisters: Laura and Sandra"?


A) IX‐I HAVE sss-d LAURA ss-nd SANSRA 2 SISTERS

B) ss-d LAURA ss-nd SANDRA 2 SISTERS IX‐I HAVE

C) SISTERS IX‐I HAVE 2 ss-d LAURA ss-nd SANDRA

D) 2 IX‐I HAVE ss-d LAURA ss-nd SANDRA SISTERS

Answers

D because the order of the name and how many people there are

Answer:

C) SISTERS IX‐I HAVE 2 ss-d LAURA ss-nd SANDRA

Explanation:

I just took the quiz. :D

Have a nice day.

एप्पल के संस्थापक कौन है??
.
Who is the founder of Apple??
.
don't use gugle and Alexa​

Answers

Answer:

Steve Jobs is founder of APPLE

Answer:

Steve Jobs.....,................

He found a crops in the well. ( into ' who ' question ) convent into target question ​

Answers

Answer:

Who found a crops in the well?

Explanation:

But the part "a crops" is grammatically incorrect, so it should be "crops" or "a crop" instead.

arts stream murdabad


i am hate arts stream and yours ​

Answers

Answer:

why bro u hated it .............

What are you talking about?? lol

Masalah yang disampaikan seseorang dengan kata katanya sendiri, namun sebelumnya telah menyiapkan pokok pokok yang ditulis seseorang dalam menyampaikan pidato adalah metode pidato menggunakan?

Answers

Answer:

metode berpidato dengan cara menghapalkan naskah teks pidato terlebih dahulu.

Answer:

Memoriter.

Explanation:

Pidato merupakan kegiatan berbicara didepan umum untuk menyampaikan sebuah gagasan.

Ciri-ciri dari pidato yaitu:

Memiliki tujuan.Isinya fakta atau tidak mengada-adaCara penyampaiannya disesuaikan dengan para pendengar.Dibuat secara semenarik mungkin.

Di dalam berpidato, terdapat empat metode yang dapat kita gunakan, yaitu:

Improptu. Improptu adalah sebuah metode berpidato yang dilakukan secara spontan tanpa melakukan persiapan sebelumnya. Metode improptu biasa digunakan oleh orang yang pandai berimprovisasi dengan baik di depan banyak orang.Memoriter. Momoriter adalah metode dalam berpidato yang dilakukan dengan cara menghafal teks sebelum berpidato.Naskah. Naskah adalah metode berpidato yang dilakukan dengan cara membawa catatan dan membacanya. Berpidato dengan metode naskah cocok digunakan oleh orang yang tidak pandai berimprovisasi kata-kata di depan banyak orang.Ekstemporan. Estemporan adalah metode dalam berpidato yang dilakukan dengan cara menyampaikan poin-poin pidato saja. Jadi, orang yang berpidato menyiapkan sebuah teks, kemudian memilih poin-poinnya saja dari teks tersebut untuk disampaikan.

#Let'sSpeakIndonesian

1.
Which statement best describes imagery?
using words to tell how to accomplish a task
using images instead of words
using images to show readers what the text says
using words to paint a picture in the reader's mind

Answers

Answer:

D. Using words to paint a picture in the reader's mind.

Explanation:

Imagery is figurative language that is descriptive details to, like the answer says, paint a picture. Imagery usually uses multiple adjectives and is very specific. Ex. The great feeling of the shining warm sunlight hit my skin while the beautiful birds sang a lovely song.

Answer: D

Explanation:

Other Questions
Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3- e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data What does the narrators description of the wallpaper reveal about the context of the story? The narrator feels imprisoned by her life. The narrator wants everyone to study the wallpaper. The narrator thinks that the wallpaper hides a secret room. The narrator prefers to do her writing work at night. Which phrase best describes the harlem renaissance?. Which graph could potentially have a correlation coeffiecient (r value) of 0.95? According to his running log, Baldwin averaged 4 miles per week last month and 25% more this month. How much did he average this month? can hellp me with this plzzzzzzz no links plz how are continental climates different from temperate climates Which word from Juliet's conversation with her mother is understood oneway by Lady Capulet and another way by the audience?A. CousinB. HeartC. TemperD. Love When corn is to be planted by the Indians, it is the work of the women folk to see to the sorting and cleaning of the best seed. It is also the women's work to see to the planting. (This was in olden times.)After the best seed has been selected, the planter measures the corn, lays down a layer of hay, then a layer of corn. Over this corn they sprinkle warm water and cover it with another layer of hay, then bind hay about the bundle and hang it up in a spot where the warm rays of the sun can strike it. While the corn is hanging in the sun, the ground is being prepared to receive it. Having finished the task of preparing the ground, the woman takes down her seed corn, which has by this time sprouted. Then she proceeds to plant the corn. Before she plants the first hill, she extends her heavenwards and asks the Great Spirit to bless her work, that she may have a good yield. After her prayer she takes four kernels and plants one at the north, one at the south, one at the east and one at the west sides of the first hill. This is asking the Great Spirit to give summer rain and sunshine to bring forth a good crop. For different growths of the corn, the women have an interpretation as to the character of the one who planted it.1st. Where the corn grows in straight rows and the cob is full of kernels to the end, this signifies that the planter of this corn is of an exemplary character, and is very truthful and thoughtful.2nd. If the rows on the ears of corn are irregular and broken, the planter is considered careless and unthoughtful. Also disorderly and slovenly about her house and person.3rd. When an ear of corn bears a few scattering kernels with spaces producing no corn, it is said that is a good sign that the planter will live to a ripe old age. So old will they be that like the corn, their teeth will be few and far between.4th. When a stalk bears a great many nubbins, or small ears growing around the large one, it is a sign that the planter is from a large and respectable family.After the corn is gathered, it is boiled into sweet corn and made into hominy; parched and mixed with buffalo tallow and rolled into round balls, and used at feasts, or carried by the warriors on the warpath as food. When there has been a good crop of corn, an ear is always tied at the top of the medicine pole, of the sun dance, in thanks to the Great Spirit for his goodness to them in sending a bountiful crop.Required:In one to two sentences, explain what the reaction of the Sioux to a good crop shows about the Sioux people. 1) 0.52 + 1.6 + 8.26 =2) 1.4 + 5.98 + 9 + 0.39 =3) 4.45 + 7 + 0.049 =4) 12.54 1. 054 =5) 0. 685 0. 5903 =6) (34. 89) (0.875) =7) (840) (0.625) =8) 28.5 0.87 =9) 104 6.4 = how does one make a plush design for a character with floating limbs metabolism is the chemical process your body uses to breakdown and transform food Help help help help help A number is chosen uniformly at random from among the positive integers less than $10^8$. Given that the sum of the digits of the number is 9, what is the probability that the number is prime Plays tell stories and have characters with conflict. They are written:to be performed on stageto be read silentlyto be ignoredall of the above the study of heritability of behavioral traits is called What are the first three books of the old testament Round 68,533 to the nearest hundred.