Find the circumference of a quarter of the circle (radius = 6)​

Answers

Answer 1

Answer:

rajjsjdjdjxkkdkdkdkkdjxjjdjxjckfkjdjfuidid


Related Questions

Help dudhfsdhdhdhhddh

Answers

Answer:

just multiply

76x475=36100 apples

Suppose that Stephen is the quality control supervisor for a food distribution company. A shipment containing many thousands of apples has just arrived. Unknown to Stephen, 13% of the apples are damaged due to bruising, worms, or other defects. If Stephen samples 10 apples from the shipment, use the binomial distribution to estimate the probability that his sample will contain at least one damaged apple. Select the true statement.
A. Stephen can use a sample of size 10 to reliably determine if the truck load contains damaged apples.
B. Stephen could use a sample of size less than 10 to reliably determine if the truck load contains damaged apples.
C. Stephen could have used a normal approximation to determine this probability.
D. A sample of size 10 is too small to reliably determine if the truck load contains damaged apples.
E. Stephen should sample with replacement so that the probability is exactly binomial.

Answers

Answer:

D. A sample of size 10 is too small to reliably determine if the truck load contains damaged apples.

Step-by-step explanation:

We have probability of having damaged apple = 13%

= 13/100

= 0.13

Sample size n = 10

Using the binomial distribution

P(X=x) = nCx * P^x(1-P)^n-x

Probability sample will have at least one damaged apple

= P(X>=1) = 1-p(x<1)

= 1 - P(X=0)

= 1-(10C0 *P⁰(1-0.13)¹⁰

= 1 - 1(1-0.13)¹⁰

= 1 - 0.87¹⁰

= 1 - 0.2484

= 0.7516

The answer is option D. A sample of size 10 is too small to reliably determine if the truck load contains damaged apples.

A CD player is advertised at a price of $1200. It could be bought cash or by hire purchase. The table below shows the terms of payment.

Answers

Cash:1140
Option 1:1344
Option 2:1320



what is 47 ÷ 12 1/3 =​

Answers

Answer: 47/363

(Decimal: 0.129477)

Solve for xy^m=yx^2 for m​

Answers

Answer:

[tex]m = \frac{ln(xy)}{ln(y)} [/tex]

Step-by-step explanation:

divide both sides by x

simplify

apply exponent rules: mln(y)=ln(xy)

m=ln(xy)/ln(y)

Paleomagnetic studies of Canadian volcanic rock known as the Carmacks Group have recently been completed. The studies revealed that the northward displacement of the rock units has an approximately normal distribution with a standard deviation of 500 kilometers (Canadian Journal of Earth Sciences, Vol. 27, 1990). One group of researchers estimated the mean displacement at 1,200 kilometers, whereas a second group estimated the mean at 1,000 kilometers.

Required:
a. Assuming the mean is 1500 kilometers, what is the probability of a northward displacement of less than 500 kilometers?
b. Assuming the mean is 1200 kilometers, what is the probability of a northward displacement of less than 500 kilometers?
c. If, in fact, the northward displacement is less than 500 kilometers, which is the more plausible mean, 1200 or 1500 kilometers?

Answers

Answer:

a) 0.0228 = 2.28% probability of a northward displacement of less than 500 kilometers

b) 0.0808 = 8.08% probability of a northward displacement of less than 500 kilometers

c) 1200 kilometers, because in this case, the will be a higher probability of a northward displacement that is less than 500 kilometers.

Step-by-step explanation:

Normal Probability Distribution:

Problems of normal distributions can be solved using the z-score formula.

In a set with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the zscore of a measure X is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

The Z-score measures how many standard deviations the measure is from the mean. After finding the Z-score, we look at the z-score table and find the p-value associated with this z-score. This p-value is the probability that the value of the measure is smaller than X, that is, the percentile of X. Subtracting 1 by the pvalue, we get the probability that the value of the measure is greater than X.

Standard deviation of 500 kilometers

This means that [tex]\sigma = 500[/tex]

a. Assuming the mean is 1500 kilometers, what is the probability of a northward displacement of less than 500 kilometers?

Mean of 1500 km means that [tex]\mu = 500[/tex]

The probability is the pvalue of Z when X = 500. So

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

[tex]Z = \frac{500 - 1500}{500}[/tex]

[tex]Z = -2[/tex]

[tex]Z = -2[/tex] has a pvalue of 0.0228

0.0228 = 2.28% probability of a northward displacement of less than 500 kilometers.

b. Assuming the mean is 1200 kilometers, what is the probability of a northward displacement of less than 500 kilometers?

Now [tex]\mu = 1200[/tex]

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

[tex]Z = \frac{500 - 1200}{500}[/tex]

[tex]Z = -1.4[/tex]

[tex]Z = -1.4[/tex] has a pvalue of 0.0808

0.0808 = 8.08% probability of a northward displacement of less than 500 kilometers.

c. If, in fact, the northward displacement is less than 500 kilometers, which is the more plausible mean, 1200 or 1500 kilometers?

1200 kilometers, because in this case, the will be a higher probability of a northward displacement that is less than 500 kilometers.

What is the CONSTANT in the expression 3k + 12?

Answers

Answer: 12

Step-by-step explanation:

The constant of the expression is 12.

What is a constant?

'A constant is a value or number that never changes in expression that is it's constantly the same.'

According to the given problem,

In the expression 3k + 12 , k is a variable. A variable is a quantity that may change with respect to the mathematical criteria.

If k = 1, the value of the expression is (3 × 1) + 12 = 15

  k =2, the value is (3 × 2) + 12 = 18

But we can see that no matter the value of k is, the expression has to be added with 12.

Hence, we can conclude that since the value of 12 does not change irrespective of the changing values k, the constant of this expression is 12.

Learn more about constant here:

https://brainly.com/question/18650947

#SPJ2

Janet bought 12 guavas and 16 apples. What is the ratio of guavas to apples?

Answers

12 : 16

divide by 4

3 : 4

that's it

Use the series below to answer the following questions.

Answers

Sorry but u didn’t put a picture

HELP ME NOW PLEASE!!!!!
The question says "State the coordinates of Point G after a rotation of 90 degrees clockwise followed by a dilation with scale factor 2." The coordinates are G(4.5, 3).

Answers

Answer:

Hiiiiiiiiiiiii Picture pls?

Step-by-step explanation:

:))

Solve for x by means of factorisation:
1
x2 - 10x + 21 = 0​

Answers

Answer:

Solving this will give us the following two solutions:

x = (10 + 4) /2 = 14/2 = 7

x = (10 - 4) /2 = 6/2 = 3

Step-by-step explanation:

hope this helps!

could i get brainliest?

(PLEASE HELP)James tosses a coin 50 times. It lands on heads 23 times and on tails 27 times.
What is the relative frequency of the coin landing on heads in this experiment?

A 23%

B 46%

C 50%

D 54%

Answers

Answer:

b

Step-by-step explanation:

Please help me ASAP
WILL MARK BRAINLY

3. When using the vertical method to multiply polynomials, your like terms must be lined up in what
rows
columns
descending order
ascending order

Answers

Answer:

column

Step-by-step explanation:

hope it will help you

Answer:

B. Columns

Step-by-step explanation:

How many solutions does the system of equations have?

a. no solution
b. one solution x=0, y=5
c. One solution x=1, y=4
d. Infinitely many solutions

Answers

Answer:

one solution at x=1,y=4 point

Answer is =c due to the one solution

Put the equation y =x^2-8x + 12 into the form y(x-h)^2+k
Answer: y =

Answers

Answer:

y = (x - 4)² - 4

Step-by-step explanation:

y = x² - 8x + 12

y = ( x² - 2(4)x + 4² ) - 4² + 12

y = (x - 4)² - 4

URGENT PLEASE, I NEED THIS FOR A TEST RIGHT NOW- A jar one-fifth filled with water weighs 560g. The same jar four-fifth filled with water weighs 740g. What is the weight of the empty jar??

Answers

Answer:

493g.

Step-by-step explanation:

The volume of a suitcase if 8,556 cubic inches. It is 32 inches long and 15.5 inches high. What is width of the suitcase?

Answers

Answer:

17.25

Step-by-step explanation:

8556 / 32 / 15.5 = 17.25

A rectangular prism measures 8 inches in width, 12 inches in length, and 4 inches in height. What is the surface area of the prism? Enter your answer in the box.

Answers

Answer is in the file below

cutt.us/brainly

A=352in2

A=2(wl+hl+hw)=2·(8·12+4·12+4·8)=352in²


All trapezoids have one right angle?

Answers

Answer:

a trapezoid can have either 2 right angles or no right angles at all

Step-by-step explanation:

$200 in a savings account. The interest rate is 3%. Determine the exact amount of money that will be in the
account after the following amounts of time.
a) 2 months: b) 6 months:

c) 11 months: d) 1 year:

e) 2.5 years: f) 5 years:

Answers

Answer:

what

Step-by-step explanation:

the difference of 4 , and 5 times h

Answers

Answer:

Step-by-step explanation:

4 - 5*h

The question is not totally clear. It could be the other way around.

5h - 4

Given the grammar, I'll stick with the first answer.

If Fx) = 8x, which of the following is the inverse of F(x)?

Answers

hope this helps . it’s quite a simple

Answer

y=x/8

Step-by-step explanation:

f(x)=8x

f(x)=y

y=8x(interchange the values)

x=8y(divide by 8 both sides)

y=x/8

11. find the value of x in the kite below.
E
(6x + 6)
F
Р
G

Answers

14.

Step-by-step explanation:

6x+6=90 (being a straight line)

6x=90-6

6x=84

x= 84/6

x=14.

Which statement best describes the point (2,-5)
A.5 units to the left and 2 units up from the origin
B. 5 units to the right and 2 units up from the origin
C. 2 units from the left and 5 units down from the origin
D. 2 units to the right and 5 units down from the origin
HELPPPPPP!!!!!!!

Answers

I believe your answer would be C. Hope this helped!

Determine whether the figure has line point and or rotational symmetry

Answers

Answer:

D) rotational and point

Step-by-step explanation:

D) rotational and point

A high school Band has a budget of $1500 this year. They plan to go to the State Competition which cost $450. How many Members of the band can attend if the uniforms have a cost of $25 each. let n represent the number of bandmates
Group of answer choices

Answers:
n > 60

n > 42

n < 42

n < 78

Answers

Answer:

n < 42

Step-by-step explanation:

450 + 25n < 1500   (Has to be less than 1500)

25n < 1500 - 450

25n < 1050

n < 42

Answer:

n < 42

450 + 25n < 1500    

25n < 1500 - 450

25n < 1050

n < 42

AccelGR7_Math_T6_FSQ_OL_FY21
Look at this system of linear equations.
S2x + 3y =-4
ly = 2x +4
What is the solution to the system of linear equations?
X = -2, y = 0
x= – 1, y = 2
x = 4, y = - 4
x = 2, y = 8

Answers

Answer:

x=-2 and y =0

Step-by-step explanation:

2x + 3y=-4

y=2x + 4

2x -y = -4

4y= 0

y = 0

2x -0=-4

2x =-4

x=-2

I need a answer ASAP​

Answers

Answer:

8

Step-by-step explanation:

y = (10x^2 + 3x^4)/ 2x^2

where x is not equal to 0

(20x + 12x)/4x

32x / 4x

= 8

What is the difference between change in quantity and change in quantity demanded? ​

Answers

A change in demand means that the entire demand curve shifts either left or right. A change in quantity demanded refers to a movement along the demand curve, which is caused only by a chance in price.

An online store sells specialty bags. They charge $8 for shipping and $21 per bag ordered.

Write an expression that can be used to find the cost in dollars for b bags including shipping.

Answers

Answer:

b=21x+8

Step-by-step explanation:

she sell bags 21 dollars for every bag(x) and they only add 8 dollars 1 time

Other Questions
Pls I need help thank you 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA HURRY I NEED HELPP!! What is the value of the expression: 2/10 5/4?1/504/108/501/2 What two numbers have a sum of 215 and a difference of 137 work out 56 - 8 2 what is the order from least to greatest(38%,3/8,0.4,1/3,41%,0.33) John ate three hot dogs at a hot dog eating contest in 45 seconds. How many hot dogsshould he be able to eat in the 5 minute contest limit? show work Using the figure, angels p and w are example of Answer :) Hellohello, if you able to help me then please do. (: Carol Beal is the export manager at Gudrun Sjoden USA, a licensed distributor for a Swedish designer. Carol has North America and all of Asia in her territory. She has just formed a joint venture to run retail branches in Tokyo, Shanghai, and Seoul. Her plan is to ship directly from the Gudrun Sjoden warehouse in Stockholm. Her Asian partner has requested she ship to her DDP, but Carol would prefer to ship Ex Works. Carol knows that there are critical differences between the two terms of sale and is reviewing what decision to make. She wants to keep her U.S. expenses as low as possible, and she would be funding the shipping out of the United States. She also wants to continue to build a good, solid, trusting relationship with her joint venture partner.Which statement is true Carol ships goods Ex Works? a. The buyer would cover shipping and insurance costs assume the risk the door. b. The seller would cover all insurance costs while the buyer would cover the cost of shipping. c. The goods be shipped from Stockholm at the seller's expense. d. The seller would cover all shipping and insurance costs and assume the risk at the factory door. e. The buyer would cover all insurance costs while the seller would cover the cost of shipping 2.95___2.949 which is greater I need help what's the answer anyone? Circle a is defined as (x+5)^2 + (y+6)^2 + 16, and circle b is defined as (x+3)^2+(y+2)^2 =9. Which transformation of circle a shows that circle b is similar? 4) A drag racer starts her car from rest and accelerates at 10.0 m/s for a distance of 400 m (1/4 mile). (a) How long did it take the race car to travel this distance? (b) What is the speed of the race car at the end of the run? Define paternalism with regard to European imperialism: Law of Sines: Homework please help Help ASAP pleaseee lol A waste product carried by the blood:oxygenenzymescarbon dioxidehormones Which expressions are equivalent to the given expression?y^-8y^3x^0x^-21.) x^-2y^-52.) 1/y^243.) x^2y^-114.) x^2/y^115.) y^-246.) 1/x^2y^5I hope this makes sense but I dont understand it