HELP PLEASE ASAP!!!
Vocabulary:
In each of the following sets of words, underline the one word that does not belong. Then write a sentence explaining why it does not fit.

1 hooligan
hoodlum
humdrum
rascal

2 burly
sonorous
husky
muscular


3 posh
salute
greet
hail


4 stein
goblet
vessel
careen


5 scrounge
offer
forage
wheedle


6 hesitate
lumber
plod
shamble

7 shawl
serif
cape
stole

Answers

Answer 1

Answer: Humdrum doesn't belong here because it is a word that is used to show lack of motivation or variety.

Sonorous: Word that is used to describe something loud or thundering(?) you obviously can notice that the other words are used to describe something that is physical/ material as the body of a person.

Posh: A fancy word for elegant, elegant doesn't fit when you are trying to salute someone, you can't said "Posh! the day is beautiful".

Careen: Word used to tell that a car is out of the street, the others words are used to describe an object, like cups or boats, big containers.

Forage:   Is something related to animals/ people, search widely for food or provisions, the other words are synonyms of persuade( convince others to do something for you).

This one is hard ! I will said that is "Shamble" because this one need to be next to a pronoun to point that this character is moving in a slow, heavy way when the others doesn't need it.

Serif: Word use it to describe the slight projection finishing off a stroke of a letter in certain typefaces.

Explanation: Good Luck!


Related Questions

1. Having a special day for fathers was the idea of a Spokane, Washington,
woman.

Answers

Answer:

washington

Explanation:

this led to creating of father's day

Who impacted the world most? Does anyone know someone that’s easy to write an essay about, creating a huge impact on the world today, with many achievements? If you do, please tell me a little bit about them thanks

Answers

Here's someone for you:

Fred Rogers. Fred Rogers was a kids TV host and activist against consumerism. He made his debut in 1963 with his classic intro. He was open about his flaws, and sadly passed from stomach cancer in 2003.

If you want anyone else I've got a lot of brief summaries + links

PLS ANSWERRRR
Was Buck a strong leader?

Explain how Buck helped his fellow sled dogs survive in the Yukon.

PLS PUT 3 QUOTES TO SUPPORT HIE BUCK HELP SUPPORT HIE HE HELPED THE SLED DOGS

TYSM!! i will mark branliest!

Answers

Answer:Mainly, Buck needed to be brave and strong, but he also needed to be be clever and to learn about how a dog team worked. When Buck got to the Yukon and began working as part of a dog team, he quickly became strong. He had always been brave. But those were not enough to make him qualified to lead the pack.

Explanation:

Explain 4 reason what are the causes for students to drop out from university​

Answers

Answer:

While financial issues are probably the most common reason for dropping out of college, every student has their own reasons. Some unfortunately have family issues, a lack of support, or unexpected medical problems that are beyond their control.'

Financial problems.

Poor secondary school preparation.  

The student is not sure or convinced with the major.  

Conflict with work and family commitments.  

Increasingly failing courses.  

Lack of quality time with teachers and counsellors.  

De-motivating school environment.  

Lack of student support.

Answer:

Beyond any other signal, this is perhaps the primary predictor of student attrition. These financial problems are mainly due to a caregiver (either the student or a guardian) losing their jobs, which adds a psychological stress to a financial predicament.

For instance, according to Times Higher Education, 1 out of 4 college students in Germany broke off their studies early due to either financial problems, poor student professor relationships or lack of motivation.

Margerite McNeal. writer and editor, explains how this issue has turned more complicated in the United States due to student loans, as over 40% of student borrowers are not making payments on their loans, which adds to a vicious student debt cycle that pushes them out of school. She quotes former Secretary of Education Arne Duncan saying “The most expensive degree is the one you do not complete.”

According to Collegeview.com, some students “underestimate college costs and realize too late that they lack the funds to cover it all. Others decide they would rather be making money working full time than pursuing a costly degree.”

2. Poor secondary school preparation

Even though colleges and universities are addressing student’s lack of readiness they inherit from high school in areas such as language and mathematics, there is a point where students cannot cope or handle the workload anymore and leave school.

Margerite McNeal is very harsh at saying that, in the United States: “Higher-ed institutions point fingers at high schools for sending them underprepared students who drop out because they cannot keep up with coursework, but colleges and universities are not innocent victims. They can be doing more to help students succeed even before matriculation.”

It is not just the level of the degrees, but the mental attitude. In Spain, for instance, Times Higher Education points out that some people that enter university from vocational training “can have problems getting to groups with the theoretical side of their degree. Others are disoriented by the change from the structured school environment to the more autonomous university world.”

3. The student is not sure or convinced with the major

Any college teacher sees two trends here: either the major failed to meet the student’s expectations, or the major wasn’t the student’s first choice.

When asked about their major, a common phrase that freshmen and sophomore students in the United States tell teachers when they introduce themselves at the beginning of the year is:

“I am undecided.”

In Latin America, this is completely different. In countries such as Chile, 17 and 18-year-olds are virtually forced to pick a 4 to 7-year major, with almost no room to find themselves first.

Students in programs and universities with a low entry requirements threshol – such as social sciences – tend to have a higher dropout rate than majors that have higher requirements to enroll in the first place, such as medical degrees (which in Latin America begins at an undergraduate level).

This is gradually changing, as universities are slowly adopting college-mode baccalaureates and common core education to provide orientation.

4. Conflict with work and family commitments

This happens both in undergraduate degrees and postgraduate education. According to a study by the Bill and Melinda Gates Foundation, the main reason why of students dropping out of college in 2009 was this conflict of interest between school, the job and the family.

“Many students who drop out of college have to work while enrolled in college. They often find it very difficult to support themselves and their families and go to college at the same time. Many have dependent children and enroll part-time. Many lack adequate support from parents and student aid.”

While this is also a financial issue, this work-study balance has many other underlying problems. 3 out of 4 respondents said that work contributed to the decision to drop out, and 1 out of 3 said that balancing work and school was “too stressful.”

why police personnel and other military department are deployed in times of disasters.​

Answers

Answer: It is axiomatic that a police department is charged at all times

with the duty of preserving life and property. Such a responsibility

not only requires the proper and effective handling of routine

problems, but, in particular, it requires the planning and adoption

of forceful techniques of enforcement in the event that disaster

or emergency arises. This is true in times of peace. It is vital in

times of war. Fire, storm and flood, industrial hazards, subversive

activities . . . these count among the many catastrophies and

disasters which may overtake a city. In anticipation of them, it is

the alert police department which has already formulated plans

in advance whereby all its available resources can be instantly

utilized for the general welfare of its people.

When disaster arises, one of the most difficult and yet important

tasks of the police is to keep the channels of transportation and

communication open. If these are clogged, the entire program for

combating the disaster is imperiled. It is the purpose of this

article to set forth in broad details how one of our largest police

departments-that of Los Angeles, California-has developed a

plan of deployment of traffic personnel during disaster emergency.

Since emergency traffic control during peacetime disasters (such

as floods or earthquakes) and that necessitated during wartime

differ principally in the size of the area affected, it is deemed

expedient at this time to consider the problem in its larger wartime

phases.

Select the correct answer.
What type of negative business message does this statement convey?

We noted your comment about your problem with our hairstyling gel. Thanks for bringing it to our attention. Could you please message me your email or phone number?

A.
denying a request
B.
explaining a service fault
C.
rejecting a claim
D.
responding to a social media post
E.
apologizing for a mistake

Answers

Answer:

the answe is e

Explanation:

just seems right

Answer:

responding to a social media post

Explanation:

they aren't denying or rejecting anything, explaining anything, or apologizing.

they are responding to a "comment" on social media and asking for contact info to follow up.

Is my report grammar amazing? Need help asap, please.

The melting of the polar ice caps.



There are millions of polar ice caps in the world and there are Millions of wildlife and organisms living on them. They can grow enormous up to 50,000 square kilometers. They take up 14.6 million km of the earth. They are getting smaller day by day and night by night. They are melting. At the rate that it is melting by 2035, the polar ice caps will be gone and all coastal cities will be flooded and destroyed. The polar ice caps would have been around for millions of years in the world's oldest architecture. There are so many animals that live under polar ice caps. Some animals are brown bears, polar bears, arctic foxes and wolves, whales, birds, fish, krill, penguins, etc. There are so many animals that stay alive on and under the ice caps. The environment is perfect for the animals and we are ruining it for those animals. The ecosystem under the icecaps is amazing. It is a great place for fish, krill, and aquatic organisms. It is a safe spot for small animals because the animals on top of the ice caps won't go into the water unless they have to because there are bigger predators in the water like leopard seals, killer whales, and big fish. More and more animals die every day because the ice caps are getting smaller and smaller There are big rivers that are flowing into the ocean from the ice caps. These Rivers are bad because they flood everywhere and it ruins animals' homes and shelters. It is also good because now the animals can drink and not have to worry about getting eaten by a leopard seal or a killer whale, but now the animals will overpopulate and be indeed for more food. Every day billions of tons of ice melt, and the ice caps have 90% of the freshwater on earth. The ice caps are breaking apart and big chunks of them are starting to fall into the water which isn't good because they are raising the sea level. They are not good to have in our ocean because the broken pieces take a long time to melt and those big chunks float and also hit boats or other ice caps that break apart them. It is not good to have thousands of ice caps scattered around the take up The only way we can slow down the process of melting is if we stop burning so much energy and use solar or electric power to do our daily tasks driving places and burning trash. Electric cars are great for the world but we need to find a better power source because it is hard to get so much electrical energy from the earth. Solar power is another way millions of people use solar power on their roofs of their houses so that the power that they receive from the sun is subtracted from their electrical bill. It is a great power source but it is not as effective because it requires an extremely strong energy source to power them. Luckily we have the sun and that helps out a bunch. Climate change also is a huge factor in the melting of the polar ice caps. When the climate changes everything has to adjust to that climate and the ice caps can't. Over the past 100 years, the climate has changed by 1.0o F. That is a lot. Even though it seems so small for the climate to change it takes a lot of burning fuel and waste. We cut and burn so much wood, metal, biofuel, trash, etc. We all do it even if you think you recycle some of it still is burned so try to reuse your trash as much as possible. When we reuse something it proves that something can be used twice rather than throwing it out without seeing what you could do with it. You can reuse anything like plastic water bottles, home depot buckets, plastic straws, fruit cups, and much more. Everything helps the environment and you should make a difference by going out of your way to do things for the environment. Picking up trash on the road, sidewalk, forest, buildings, or anywhere you can think of. When you do a small act of kindness you can feel better. You also help the ice caps from melting faster. So do the right thing and make a difference.

Answers

Answer:

Yes, it's really good!

Explanation:

You can use Grammarly to see if their is any mistakes.

how is the price of a product determined

Answers

Answer:

The price of a product is determined by the law of supply and demand. ... The equilibrium market price of a good is the price at which quantity supplied equals quantity demanded. Graphically, the supply and demand curves intersect at the equilibrium price.

Explanation:

The price of a product is determined by the law of supply and demand. Consumers have a desire to acquire a product, and producers manufacture a supply to meet this demand. The equilibrium market price of a good is the price at which quantity supplied equals quantity demanded. Graphically, the supply and demand curves intersect at the equilibrium price.

Which is the most likely effect of an allusion that is too dramatic for the
context?
A. The reader will be able to picture the scene.
B. The reader will be impressed.
C. The reader will feel strong emotions.
D. The reader will not take it seriously.

Answers

Answer:

D

Explanation:

Answer:

D

Explanation:

someone please help marking brainliest
who can help me with my sba via g mail

Answers

Answer:

i can what is it

Explanation:

please mark brainlest

Images were taken by special roving camp photographers who traveled with troops. Correct the sentence by adding or deleting commas as needed.

Answers

Answer:

Images were taken by a special roving camp that traveled with troops .

Explanation:

Suppose that I have spoil water on my friend project work. Write a letter of apology.​

Answers

Answer:

Dear (name of friend),

How are you? I hope you are doing fine. I am writing this letter to apologise about the fact that I spilled water on your project work. I know how much effort you have put into this project, even if you didn't too much or did much, I want to tell you how sorry I am. I hope you will forgive me for what I did and I won't do it again.

Cheers,

(Your name)

I don't know if this is for an assignment or anything, but here's my response. :-)

how does the author develop hollings point of view

Answers

he really thinks about how it looks and thinks about how he would feel in that moment

4. Why do the workers burst out laughing when John calls the Director "My father!"?​

Answers

because john was playing Luke skywalker in a Star Wars movie DUH.

In paragraph 5, of Passage 1, the author uses flashback to introduce the narrator’s experience in Basil Hallway’s studio. How does this structural device contribute to the meaning of the text?

A. The use of flashback adds an element of suspense to the text because it reveals a chilling reason as to why the narrator misreads the painting.

B. The use of flashback adds an element of mystery to the text because it reveals a surprising reason regarding why the narrator questions what he sees in the painting.

C. The use of flashback adds an element of surprise to the text because it reveals a curious reason as to why the narrator misunderstands what he sees in the painting.

D. The use of flashback adds an element of tension to the text because it reveals a stressful situation to explain why the narrator may be confused about what he sees in the painting.

Answers

Answer:

Correct answer is B.the use of flashback adds an element of mystery to the text because it reveals a surprising reason regarding why the narrator questions what he sees in the painting

Explanation:

The structural device contributes to the meaning of the text through the use of flashbacks and adds an element of mystery to the text. Thus, option B is correct.

What is a Structural device?

Depending on who narrates the narrative, how it is delivered, or how the story's components are arranged, a structural device may be used. The author selects these techniques for impact, such as to manage the reader's experience of the details, to manage the narrative's pacing, or to enhance the work's beauty or significance.

The structural device adds mystery to the text by using flashbacks to further the meaning of the text and by disclosing a surprise explanation for why the narrator doubts what he sees in the painting. So, choice B is the correct one.

Learn more about Structural devices here:

https://brainly.com/question/24452838

#SPJ6

The problems created by the Dust Bowl...

A. encouraged many city dwellers to move to the country.

B. caused people to struggle to find work.

C. helped banks focus on assisting their customers.

D. were the result of bank failures.

Answers

Answer: I’m gonna guess it’s b..?

The problems created by the Dust Bowl  caused people to struggle to find work.

What were effects of Dust Bowl?

Steinback's fundamental reason for making The Grapes out of Wrath is to show the way that one family's battle was illustrative of various different groups of ranchers.

He formed this in order to show the unfortunate working and living territory of California's traveler workers during the 1930s.

California's focal valley. All the more then a portion of 1,000,000 individuals escaped from Oklahoma and other adjoining states during the Depression.

All the more of these individuals went to California. The greater part of these individuals were ranchers or sharecroppers. They came to California in order to observe ranch work. One of the large draws was cotton.

For more information about Dust Bowl, refer the following link:

https://brainly.com/question/11579615

If you were granted one wish to make the world a better place, what would it be?

Answers

Answer:

My wish would be to remove the world of all democracies!

Explanation:

This way everyone has freedoms!

what is the name of the four habitas ?

Answers

Answer:

The area where a particular organism lives naturally is called its habitat. The five major habitats are – forests, grasslands, deserts, mountains and polar regions, and aquatic habitat

Explanation:

What is the proper way to write out the cowboys horse was very upset.

Answers

Answer: probably give him a saddle and feed him hay

Explanation:

Can anybody tell me what is the meaning of "HPDYPYNITGOF"​

Answers

Answer:

I think it was something from HARRY POTTER

Which phrase does NOT describe historical fiction?

may provide multiple perspectives on how an event happened
shows audiences exactly how a historical event happened
tends to include everyday details about history, not just the major events
can help readers understand what motivated famous people of past eras

Answers

Answer:

B shows audiences how a historical event happened

The phrase which does not describe historical fiction is B. shows audiences exactly how a historical event happened.

Historical fiction is a work of writing that reconstructs the past which is often inpired by history and in this type of fiction, it does not show the audience how a historical event happened.

What is a historical fiction?

This is a literary genre where the story takes place in the past and captures the details of the time period as accurately as possible for authenticity, social norms, customs and tradition.

The historical fiction does not neccesarily show the audience how an event happened, rather, provides multiple perspectives on how events happened.

Read more about fiction here:

https://brainly.com/question/920795



identify three purposes of Robert D ballard's

and exploring the Titanic ​

Answers

Answer:

to inform readers about how the Titanic was discovered

to inform readers about how it feels to succeed after a long quest

to entertain readers with an exciting story

Please someone help me with these.I would be really grateful. ​

Answers

Answer: 1.B 2.A 3.D 4.D 5.B

Explanation: The second part is 1. Crashed, 2. Must've worked, 3. Did not enjoy, 4.offered, 5.do

in 250 words write a descriptive composition about myself​

Answers

Answer:

hi my name is ____. im ___ years old i was born in the great city of ____.

in my spare time i can think of nothing better than sitting down on the couch grab a fluffy warm blanket turn of the lights and turn on some good old cartoons its an amazing escape from the real world. the only thing that is better thsn that is watching cartions and eating the best food in the word ___. the first time i ever tried ___ i just feel in love with the taste of the ___. some toher facts about my is my favorite color is ___. one of my favorite memorys is the second grade. the good old days. i rember waking up and getting ready to go on a feild trip. my best friend is ___ we would do like everything togther i remeber once whenver she ______.

Explanation:

some tips is talk about some toher memorys to finish off the essay like talk about your fave birthday and stuff like that and what makes you you

Explain how a video might help you research about a specific period of time in history.

Answers

Answer: A video will provide visuals to help further explain something. using this as a multi-sensory learning environment will help further the depth of the knowledge of the time period. Showing images and telling the viewers about things that were made, built, and found in that time period will also help someone better understand what happened, and who lived in that certain time.

Hope this is helpful :)

Which of the following is not a reason Macbeth planned to kill Banquo and
his son Fleance?
O Banquo is the father of future Kings
O Banquo betrayed him
O Banquo was suspicious of Macbeth
O Macbeth was afraid of Banquo

Answers

Answer:

Banquo is the father of future kings.

Macbeth was afraid if Banquo.

Explanation:

Macbeth kills Banquo because he sees Banquo as another threat to the throne. ... Even though Banquo is his close comrade, Macbeth is now on a single-minded mission to protect himself and his position, and he kills Banquo to maintain the throne.

What are some event from Adventures of Montgomery may

Answers

Explanation:

Montgomery May traveled the world in a battered old ship. When he returned home, he told everyone about the adventures he'd had and the feats he had accomplished. 2 One of his most renowned feats was a leap.

hey can someone give me ideas on what I should write for my fictional Narrative

Answers

Fiction Prompts - Ideas for Stories

a hitchhiker, an allergy, and a mistake in a map.a cemetery, a missing dog, and a joke that goes too far.a Halloween costume, a stapler, and a complaint between neighbors.a stolen phone, a love song, and a bet.a dance competition, an engagement ring, and a worried parent.

Hope this helps if so don't hesitate to 'Thanks' and/or 'brainliest' this answer!

Seven deadly sin- when you die you become the 7th deadly sin

If the speaker wants to establish an event as a shared experience, what should they use?
A. Powerful verbs
B. Metaphor
C. Rhetorical question
D. Personal pronouns

Answers

Answer:

Personal pronouns.

Explanation:

It was terrible, we had to do x, y, and z.

X, y and z was terrible.

To establish an event as a shared experience, use:

D. Personal pronouns

The correct use of personal pronoun enables the speaker to show respect and to form an environment that is inclusive and participatory.  This is why powerful speakers, especially politicians, normally use personal pronouns.

Personal pronouns are words used as substitutes for proper names.  They include you, I, she, he, it, we them, her, me, her, us, and they.

The correct option is not option A.

Powerful verbs are uncommon and persuasive words that can trigger a response from the audience.  They cannot establish a shared experience like personal pronouns.

A metaphor is used when a comparison is being done without the use of the linking words "like" or "as" in a simile.  A metaphor does not establish a shared experience.

Rhetorical questions are asked when answers are not expected.  They only trigger an internal response from the reader, just like the use of powerful verbs.

These options leave us with option D.  Thus, personal pronouns establish events as shared experiences, making the speaker to participate in the events.

Learn how personal pronouns can be used to share experiences here: https://brainly.com/question/12139828

Through many of the early chapters of Little Women, the March girls make reference to the allegorical Pilgrim's
Progress. Explain how one of the girls, or the family as a whole, relates to the characters and themes in Pilgrim's
Progress. Include details that indicate comparisons that Louisa May Alcott makes between Little Women and Pilgrim's
Progress

Help me please. Will give brainly please help me

Answers

Answer:

This book is prefaced by the novel The Pilgrim's Progress that is a symbol of how to live as a Christian. In this preface it is included the females character of the book, Mercy, no its male character, so it is a sign that this book is a guide for young girls, it is a guide to get the salvation and the self-improvement.

Alcott wants to emphasize that religion is more important that everyday details of life. The four March sisters have to follow saintly feet and have a spiritual journey through their lives, in spite their situation as  "little tripping maids".

Other Questions
1/3 + 1/2 and I am 5 years old Please somebody help me and solve this problem Rockys rock quarry has three different sized trucks. Each truck can hold three ba the shipping manger put three bags that each hold about 200 pounds. Find the greatest common factor of 14 and 28 3. How large was the Ming Dynasty compared to the Mongols? What issues might arise from this difference? Pls I need help thank you 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA HURRY I NEED HELPP!! Please help TIA!!!!!!!! What is the value of the expression: 2/10 5/4?1/504/108/501/2 What two numbers have a sum of 215 and a difference of 137 work out 56 - 8 2 what is the order from least to greatest(38%,3/8,0.4,1/3,41%,0.33) John ate three hot dogs at a hot dog eating contest in 45 seconds. How many hot dogsshould he be able to eat in the 5 minute contest limit? show work Using the figure, angels p and w are example of Answer :) Hellohello, if you able to help me then please do. (: What is the volume of a hemisphere with a diameter of 37.6 m, rounded to the nearest tenth of a cubic meter? Carol Beal is the export manager at Gudrun Sjoden USA, a licensed distributor for a Swedish designer. Carol has North America and all of Asia in her territory. She has just formed a joint venture to run retail branches in Tokyo, Shanghai, and Seoul. Her plan is to ship directly from the Gudrun Sjoden warehouse in Stockholm. Her Asian partner has requested she ship to her DDP, but Carol would prefer to ship Ex Works. Carol knows that there are critical differences between the two terms of sale and is reviewing what decision to make. She wants to keep her U.S. expenses as low as possible, and she would be funding the shipping out of the United States. She also wants to continue to build a good, solid, trusting relationship with her joint venture partner.Which statement is true Carol ships goods Ex Works? a. The buyer would cover shipping and insurance costs assume the risk the door. b. The seller would cover all insurance costs while the buyer would cover the cost of shipping. c. The goods be shipped from Stockholm at the seller's expense. d. The seller would cover all shipping and insurance costs and assume the risk at the factory door. e. The buyer would cover all insurance costs while the seller would cover the cost of shipping 2.95___2.949 which is greater I need help what's the answer anyone?