how do all the dna structures work together is it like a machine

Answers

Answer 1

its like a twisted ladder or a double helix

how stuff works dot com

Answer 2

Explanation: Yes, It is like a machine only a person sits in a chair and they have to tell the truth while the worker asks the person questions and they have thing wrapped around there arm to tell if there telling the truth or lying so yes it is like a machine.


Related Questions

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:

PLS HELP! When I let go of a rock it falls down. What happens explain

Answers

Answer:

Gravity

Explanation:

Mark as Brainliest

Who suggested that the distance of a galaxy is proportional to its recessional speed

Answers

Answer:

Edwin Hubble

Explanation:

Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.


I need the answer no links and no putting random stuff I need the answer fast

Answers

Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.

Explanion:

its already the answer

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

Need help ASAP! Will give brainliest;) NO links please, will report.

Which statement is part of Darwin’s theory of evolution by natural selection?

A). Acquired characteristics that are inherited are the cause of evolution.

B). The organisms that are the fittest are always largest and strongest.

C). The number of offspring is not related to fitness.

D). More offspring are produced than can possibly survive.

Answers

D

More offspring are produced than can possibly survive.

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3

What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio​

Answers

The new cell has an increased surface area to volume ratio​ is a process that makes easier the exchange of materials across the surface of the cell (Option C).

What is cell division?

Cell division is the process by which cells generate new daughter cells, which may be due to mitosis or meiosis in higher organisms.

Cell division is able to increase the surface/volume ratio and therefore it facilitates the movement of materials in the resulting cells.

In conclusion, news cell has an increased surface area to volume ratio​and it makes easier the exchange of materials (Option C).

Learn more about the cell division here:

https://brainly.com/question/8283140

#SPJ1

Atoms are the most basic unit of matter. Two or more atoms from the same or different elements can combine to form molecules.
Cells are the most basic unit of life. Cells are made up of many different types of molecules. Which of the following accurately shows higher levels of organization within organisms, from least complex to most complex?
A. cells → organs → organ systems → tissues → organism
B. cells → tissues → organs → organ systems → organism
C. cells → organ systems → organs → tissues → organism
D. cells → organs → tissues → organ systems → organism

Answers

Answer:

B

Explanation:

Because cells make tissues which then combine to make organs which then further combine to form system

Which makes organisms like me and you

Answer: B

(An atom is the smallest unit of matter that retains all of the chemical properties of an element. Atoms combine to form molecules, which then interact to form solids, gases, or liquids. For example, water is composed of hydrogen and oxygen atoms that have combined to form water molecules.)

Explanation : Because cells make tissues which then combine to make organs which then further combine to form system

blue, light blue, yellow, or red

HURRY

Answers

Answer:blue

Explanation:

the answer to the question is the color blue

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

20. What is true about the esophagus? Check all that apply.* ]

Answers

Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one

Explanation:

Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *

Answers

Sincfhshjsnsheje jdhejdhdhdjdj

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart

hello please help i’ll give brainliest

Answers

Answer: Clastic sedimentary rocks are made up of pieces (clasts) of pre-existing rocks. Pieces of rock are loosened by weathering, then transported to some basin or depression where sediment is trapped. If the sediment is buried deeply, it becomes compacted and cemented, forming sedimentary rock.

Explanation:

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

son las fallas evidencias de la tectónica de placas de nuestro planeta Y por qué​

Answers

Answer:

you're speaking in the wrong language here

Explanation:

A key part of the Watson-Crick model came when Watson realized
that adenine could form hydrogen bonds with thymine and guanine
could form hydrogen bonds with cytosine. This explains why A=T
and G C in Chargaff's rules. Also, these two hydrogen-bonded
nucleotide pairs had the exact same width, so they could form the
rungs of the DNA ladder.
The fact that these pairs could match up only in this way meant that
the sequence of bases in one strand could determine the sequence
of bases in a second strand created from the first. The second strand
is said to be complementary to the first strand. Individual bases are
paired so that the identity of any base determines the identity of the
base paired with it; that is, the complementary base.
This table lists the base abbreviations for bases in a sample of single-
stranded DNA. Fill in the second column with the base abbreviations
that are complementary to the given bases.
I

Answers

Answer:

A–T

T–A

T–A

C–G

A–T

G–C

G–C

C–G

T–A

A–T

Explanation:

A always pairs up with T

C always pairs up with G

A - TT - AT - AC - GA - TG - CG-CC - GT - AA - T

A usually pairs up with TC usually pairs up with GThese are bases of amino acids called nucleotides sequences. And this helps in the bond of several base pairs to their nucleotide sequence.What is the Watson-Crick model?

In “A Structure of Deoxyribose Nucleic Acid,” Watson and Crick defined DNA as a double helix that contained long, helical strands wound together. In their model, every DNA strand contained personal devices referred to as bases, and the bases alongside one DNA strand matched the bases alongside the opposite DNA strand.

Thus it is clear that the above answer is well explained.

To know more about the DNA  refer to the link :

https://brainly.com/question/1328358

Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.

Answers

Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP

Answers

molten rocck near ground water supplies

What is likely to happen when there is more genetic diversity?

A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving

Answers

Answer:

b

Explanation:

if there is more genetic diversity then the organism will adapt much better to the environment around it

Answer:

B

Explanation:

ggggggggggggggggggggggg

When spindle fibers do not correctly separate the chromosomes during anaphase we get a condition called _________?
A. Duplication
B. Nondisjunction
C. Translocation

Answers

The answer is no disjunction

Explanation:

..........................................

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

what does arrows mean in science

Answers

It means that something lead to something else.like an chain reaction or in food chain wise this animal gains energy from this animal or plant

what is the name of the fluid found in the gall bladder​

Answers

Answer:

"Bile" is what that fluid is called

Using what you read in this passage, evaluate the following vacation
activities. Which one would cause the least disruption of the balance of
the coral reef?
A
Sport fishing on the reef
B
Scuba diving to view the reef species
с
Collecting rocks and shells as souvenirs
D
Attracting sharks to the reef with bait for photos

Answers

From the listed human activities, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

What are coral reefs?

Coral reefs are narrow and shallow stretches land where corals ate found and these corals serves as foundation for reefs to form.

The reef is an ecosystem consisting of algaes and fishes as well as some other aquatic organism.

The balance in coral reefs can be disrupted by human activities such as:

Sport fishing on the reefCollecting rocks and shells as souvenirsAttracting sharks to the reef with bait for photos

However, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

Learn more about coral reefs at: https://brainly.com/question/10970167

Other Questions
What was an effect of Reynolds v. Sims?o legislative districts had unequal numbers of peoplethe votes of urban voters carried more weight than those of rural votersstate legislatures became more representative of the peoplecontrol of state legislatures shifted to rural districts Please help me with this homework show me how you get it and the answer What are two meanings of the multiple-meaning word close?things you wearnearbyto shut(multiple chioce choose 2)to finish a deal Which sentence in the passage uses parallel structure?Online learning is constantly evolving as learning trends change. Over the last decade, many schools adopted online learning managementsystems so students can receive personalized assignments and for completing assignments outside of the classroom. Now, there is a push forstimulations and virtual reality. Some tech savvy educators believe that virtual reality is beneficial to content areas such as biology, physics, andhistory. These educators say that virtual reality will help students experience historical events, experience conducting experiments, and interactwith other students in real-life situations. WORTH 30!!!Find the value of tan theta, if cos theta= 4/5; 0< theta < 90 You have a job interview that is 330 miles away. If your average driving speed is 55 miles per hour, how long will it take you to get there? Show your work. Check your answer. Please solve ASAP please Regina owns a book store. She sold 87, 94, 91, and 84 books on the first 4 days of this week. Regina wants to have a mean of 90 books sold after 5 days NEED IT FAST Which of the following best supports the below statement?The addition of bike lanes can help improve safety for cyclists, drivers, andpedestrians.Select one:Several communities have implemented bike lane programs to keep cyclists, drivers,and pedestrians safe.Drivers can be dangerous to bikers and bikers can be dangerous to pedestrians,making the safety of all individuals a concern.When bike lanes are installed, cyclists, drivers, and pedestrians can travel safely inseparate areas with reduced chances of collision.Bike lanes will likely make cyclist feel safer and will, therefore, increase the number ofcyclists who use those lanes. Can someone help me really please is 223 a good map score? what makes london different to any other settlements in england? give at least 5 differences The data are from a small moving company that moves people from urban apartment buildings to other urban apartment building in the same or different cities. The company needs assistance in predicting the labor hours for jobs so they can provide more accurate price quotes.Run two separate regressions using the data in the sections of the spreadsheet titled Regression Model 1 and Regression Model 2. Use a 95% confidence level.Fill in all the blanks below. Do not round any numbers except for when entering them in the blanks for this quiz, round these numbers to exactly 2 decimal places even if the number has only one or no decimal places. Use commas to separate thousands (e.g., 1225 should be entered as 1,225.00).Regression Model 1R Square expressed as a percentage rounded and carried out to two decimal places is ________% and Adjusted R Square expressed as a percentage rounded and carried out to two decimal places is _______%. Refer to the spreadsheet embedded in your Module 14 Regression document I provided you to see the calculation and format for answering this next question. The gap between R Square and Adjusted R Square expressed as a percentage rounded and carried out to two decimal places is 0.______%.The overall regression model (was / was not) _______ significant.Using square footage of 1,500 and mileage of 92, the model estimates that ______ hours of labor would be required, with a margin of error of _________ hours.Regression Model 2R Square expressed as a percentage rounded and carried out to two decimal places is _______% and Adjusted R Square expressed as a percentage rounded and carried out to two decimal places is _______%. Refer to the spreadsheet embedded in your Module 14 Regression document I provided you to see the calculation and format for answering this next question. The gap between R Square and Adjusted R Square expressed as a percentage rounded and carried out to two decimal places is 0.________%.The overall regression model (was / was not) __________ significant.Using square footage of 1,500, mileage of 92, and floors of 71, the model estimates that _________ hours of labor would be required, with a margin of error of ________ hours.Model SelectionBecause the R Square is (higher / lower) _________ in regression model 1 than in regression model 2 and the gap between R Square and Adjusted R Square is (smaller / larger) in regression model 1 than in regression model 2 _________ and the margin of error of the estimated labor hours is (smaller / larger) _________ in regression model 1 than in regression model 2 , we would characterize regression model (1 or 2) ___________ as being the better model. What power did the concept of"Martial Law" in society grant to theEnglish King?A. He could send someone to prison for not payingtaxes.B. He could issue a penalty to a criminal.C. He could place soldiers in the homes of the people.D. He could veto any law passed by Congress. 2 5 + 4 6 2 + 1211-551 Which expression is equivalent to 3x - (2x + 4) + 5?x+1x + 95x + 95x + 1 China had a large influence on Medieval Japan, and Japan adoptedChinese ideas in writing, art, and religion. *TrueFalse If 30% of a number equals 8, find 90% of that number. examples of veriable costs Evaluate the expression when x= -2. 2++9