What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio​

Answers

Answer 1

The new cell has an increased surface area to volume ratio​ is a process that makes easier the exchange of materials across the surface of the cell (Option C).

What is cell division?

Cell division is the process by which cells generate new daughter cells, which may be due to mitosis or meiosis in higher organisms.

Cell division is able to increase the surface/volume ratio and therefore it facilitates the movement of materials in the resulting cells.

In conclusion, news cell has an increased surface area to volume ratio​and it makes easier the exchange of materials (Option C).

Learn more about the cell division here:

https://brainly.com/question/8283140

#SPJ1


Related Questions

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

_______________________ is an animal's ability to blend into its surroundings.

a
artificial selection
b
evolution
c
natural selection
d
camouflage

Answers

D camouflage I’m assuming because that’s what camouflage is used for.

[tex] \huge \color{magenta}{ \boxed{ \large \sf \color{blue}{d. \: Camouflage}}}[/tex]

Camouflage is the use of any combination of materials, coloration, or illumination for concealment, either by making animals or objects hard to see, or by disguising them as something else. Examples include the leopard's spotted coat, the battledress of a modern soldier, and the leaf-mimic katydid's wings.

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

Which gas is used by humans in the process of cellular respiration?

Answers

Answer: Oxygen

Explanation:

During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Hope This Helps!

#[tex]AnimePower[/tex]

Answer:

oxygen

Explanation:

we breathe it in during cellular respiration

hello please help i’ll give brainliest

Answers

Answer: Clastic sedimentary rocks are made up of pieces (clasts) of pre-existing rocks. Pieces of rock are loosened by weathering, then transported to some basin or depression where sediment is trapped. If the sediment is buried deeply, it becomes compacted and cemented, forming sedimentary rock.

Explanation:

A key part of the Watson-Crick model came when Watson realized
that adenine could form hydrogen bonds with thymine and guanine
could form hydrogen bonds with cytosine. This explains why A=T
and G C in Chargaff's rules. Also, these two hydrogen-bonded
nucleotide pairs had the exact same width, so they could form the
rungs of the DNA ladder.
The fact that these pairs could match up only in this way meant that
the sequence of bases in one strand could determine the sequence
of bases in a second strand created from the first. The second strand
is said to be complementary to the first strand. Individual bases are
paired so that the identity of any base determines the identity of the
base paired with it; that is, the complementary base.
This table lists the base abbreviations for bases in a sample of single-
stranded DNA. Fill in the second column with the base abbreviations
that are complementary to the given bases.
I

Answers

Answer:

A–T

T–A

T–A

C–G

A–T

G–C

G–C

C–G

T–A

A–T

Explanation:

A always pairs up with T

C always pairs up with G

A - TT - AT - AC - GA - TG - CG-CC - GT - AA - T

A usually pairs up with TC usually pairs up with GThese are bases of amino acids called nucleotides sequences. And this helps in the bond of several base pairs to their nucleotide sequence.What is the Watson-Crick model?

In “A Structure of Deoxyribose Nucleic Acid,” Watson and Crick defined DNA as a double helix that contained long, helical strands wound together. In their model, every DNA strand contained personal devices referred to as bases, and the bases alongside one DNA strand matched the bases alongside the opposite DNA strand.

Thus it is clear that the above answer is well explained.

To know more about the DNA  refer to the link :

https://brainly.com/question/1328358

son las fallas evidencias de la tectónica de placas de nuestro planeta Y por qué​

Answers

Answer:

you're speaking in the wrong language here

Explanation:

Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.

Answers

Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.

PLS HELP! When I let go of a rock it falls down. What happens explain

Answers

Answer:

Gravity

Explanation:

Mark as Brainliest

Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *

Answers

Sincfhshjsnsheje jdhejdhdhdjdj

Who suggested that the distance of a galaxy is proportional to its recessional speed

Answers

Answer:

Edwin Hubble

Explanation:

When spindle fibers do not correctly separate the chromosomes during anaphase we get a condition called _________?
A. Duplication
B. Nondisjunction
C. Translocation

Answers

The answer is no disjunction

Explanation:

..........................................

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:

Which of the following best describes what carrying capacity is?
A
The quantity of marine life a limited water resource can sustain.
B
The maximum number of a population that an ecosystem can sustain.
C
The total amount of greenhouse gases a specific ecosystem can sustain.
D
The minimum number of predators a specific geographic area needs to sustain itself.

Answers

B. The maximum number of a population that an ecosystem can sustain.

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

The cell cycle is the life of the cell from the time it is first formed from a dividing parent cell until its own division into two cells

Answers

Explanation:

cell cycle is made up of three main parts: interphase, mitosis, and cytokinesis. Most biologists agree that interphase makes up the period of time that a cell would be preparing for cell division. Cells spend the majority of their lives in this stage. During interphase a cell is going to be growing, replicating its genetic material and essentials to carry out cell division, and proofreading the genetic material to ensure replication has occurred correctly. This doesn’t sound like much, but it’s actually the longest part of the cell cycle. Once this is complete, the cell will then go through cell division and, theoretically, split into two new cells (cytokinesis).

How cytokinesis works will depend upon the type of cell that is dividing. Here is an image that summarizes the differences in cytokinesis in plant cells and animal cells, which is the classic example used in many introductory biology courses:


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Which of the following is NOT a type of wetland?
a: marsh
b: bog
c: swamp
d: pelagic

Answers

I think it is d because the other places are of course wet lands.

Explanation:

i have no clue, but good luck, hopefully you pass the test

Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP

Answers

molten rocck near ground water supplies

Underground water is an example of

A) a hidden water source

B) a untapped water
source

C) an unusable water source

D) a high salinity water source

Answers

Answer:

i think its a hidden water source

In order for water to collect in earths atmosphere and form clouds it must first undergo what process?

A) condensation

B) convection

C) evaporation

D precipitation

Answers

Answer:

The answer is D: Precipitation

Atoms are the most basic unit of matter. Two or more atoms from the same or different elements can combine to form molecules.
Cells are the most basic unit of life. Cells are made up of many different types of molecules. Which of the following accurately shows higher levels of organization within organisms, from least complex to most complex?
A. cells → organs → organ systems → tissues → organism
B. cells → tissues → organs → organ systems → organism
C. cells → organ systems → organs → tissues → organism
D. cells → organs → tissues → organ systems → organism

Answers

Answer:

B

Explanation:

Because cells make tissues which then combine to make organs which then further combine to form system

Which makes organisms like me and you

Answer: B

(An atom is the smallest unit of matter that retains all of the chemical properties of an element. Atoms combine to form molecules, which then interact to form solids, gases, or liquids. For example, water is composed of hydrogen and oxygen atoms that have combined to form water molecules.)

Explanation : Because cells make tissues which then combine to make organs which then further combine to form system

Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.


I need the answer no links and no putting random stuff I need the answer fast

Answers

Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.

Explanion:

its already the answer

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

what is the name of the fluid found in the gall bladder​

Answers

Answer:

"Bile" is what that fluid is called

Using what you read in this passage, evaluate the following vacation
activities. Which one would cause the least disruption of the balance of
the coral reef?
A
Sport fishing on the reef
B
Scuba diving to view the reef species
с
Collecting rocks and shells as souvenirs
D
Attracting sharks to the reef with bait for photos

Answers

From the listed human activities, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

What are coral reefs?

Coral reefs are narrow and shallow stretches land where corals ate found and these corals serves as foundation for reefs to form.

The reef is an ecosystem consisting of algaes and fishes as well as some other aquatic organism.

The balance in coral reefs can be disrupted by human activities such as:

Sport fishing on the reefCollecting rocks and shells as souvenirsAttracting sharks to the reef with bait for photos

However, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

Learn more about coral reefs at: https://brainly.com/question/10970167

Other Questions
Counting a few organisms with in a population and multiplying that numberto estimate the total size of a population is an example of * how many atoms are in 4.5 moles of Al? what does the period number on the periodic table tell us? the difference of x and y is the same as 3 times the sum of x and 2 The product ( the result of a multiplication problem ) of 2 rational expressions is x+22x3 with the restrictions x 3, x32, x4 and x 5. Find an expression that meets the criteria. You may leave your answer in factored form. 1. What type of religion is Hinduism?a, Monotheisticb. Theocraticc. Polytheisticd. Enlightenment What are two steps you need to do at the end of your essay Cube X has Edge 1 in. tube why has an edge 4in longer than Cube X. which of the following describes the relationship between the cubes?a. the volume of cube why is 125 times the volume of cube X b. the volume of cube why is 25 times the volume of Cube Xc. the volume of cube x is 1/4 the volume of Cube Yd. the volume of cube x is 1/5 the volume of Cube Y What did the United States do on the islands that they captured in the Pacific?A: tested atomic bombs to warn the JapaneseB: built air basesC: built cities to create an American empireD: destroyed German buildings PLS HELP! When I let go of a rock it falls down. What happens explain Norma needs to find the sum of the fractions below. 3/8 +5/6 Norma starts by multiplying the first fraction by 3/3. By which number should she multiply the second fraction?A.8/8B.4/4c.3/3d.undefined Pls Answer ASAPin your own words explain what would happen if there was no civil war Find the value of x. ANSWER ALL THE QUESTIONS TO GET MARKED BRAINLYEST Which of the following trigonometric ratios are correct? Which of the following statements about alkynes is incorrect?Alkynes are unsaturated hydrocarbons.Alkynes have triple bonds.Alkynes are saturated hydrocarbons.Alkynes have carbon atoms. marta is infected with a sexually transmitted disease diagnosis reveals she is infected with the - which causes cervical cancer Angles of Triangles Scavenger Hunt Answer Key With which statement would the artist and the authorbe most likely to agree?Read the passage and examine the painting.In 1756, George Washington visited New York City forthe first time. He was traveling to Boston to meet withBritain's military commander. At the time of his visit,Washington was well known for his accomplishmentsas leader of the Virginia militia. New York's high-society crowd welcomed Washington as royalty andshowered him with attention.In times of darkness, look for a light.Sometimes freedom is worth fighting forO Show appreciation to those who help protectothers.O Independence is necessary to thrive. estimate 12 8/9 - 10 1/6