Which expression is equal to 6/7?

Which Expression Is Equal To 6/7?

Answers

Answer 1

Answer:

Option C

The answer is 6 ÷ 7

Step-by-step explanation:

6/7 which means 6 divided by 7 i.e., 6 ÷ 7

Thus, The answer is 6 ÷ 7

-TheUnknownScientist 72


Related Questions

Hi guys can u guys help me add 322 + 12

Answers

Answer:

334 is the answer

Step-by-step explanation:

you add them together

Answer:

334 is the right answer

Step-by-step explanation:

please mark me brainliest

Pls help me its a little confusing

Answers

Answer:

the measure of x is 38

Step-by-step explanation:

180-134=46 the value of one side of a line is 180 degrees so to find the vaule                of the inside angle we have to subtract 180 by the outside angle's

180-84=96

46+96=142 we then add the value's of both inside angles

180-142= 38

then we subtract that number by 180 because the total of all three angles of any triangle is always 180

Answer:

x = 38°

Step-by-step explanation:

Maths problem always go back to a number of foundational rules;

Once you recognise the ones that are relevant, you can then apply them to find the value or solution you want to find;

First thing is to look at the question and information provided in order to identify the relevant rules;

This question is asking for an angle and we can see a triangle (not a right-angle triangle) and line beneath it;

What rules should we think of with this in mind?

The following;

Angles in any triangle always add to 180°Angles on a straight line add to 180°

Using these rules, we can find x;

Firstly, according to rule 2, we can find angle OLM:

134 + OLM = 180

OLM = 180 - 134

OLM = 46

Secondly, also according to rule 2, we can find angle OML:

84 + OML = 180

OML = 180 - 84

OML = 96

Lastly, according to rule 1, we can find angle x:

OLM + OML + x = 180

46 + 96 + x = 180

x = 180 - 96 - 46

x = 38

Select all the correct answers.

Which three equations are equivalent to 1 +3|x-21 = 16?

O

X-2 = -5 or x - 2 = 5

X=-3 or x = 7

O

|x+2) = 5

0

x+2 = -5 or x+ 2 = 5

0

O

x=3 or x= -7

O

| x-2= 5

Answers

Answer:

Select all the correct answers.

Which three equations are equivalent to 1 +3|x-21 = 16?

O

X-2 = -5 or x - 2 = 5

X=-3 or x = 7

O

|x+2) = 5

0

x+2 = -5 or x+ 2 = 5

0

O

x=3 or x= -7

O

| x-2= 5


(3x - 4x - 2 + 3x - 6 = 180
7x – 8 =

Answers

If we collect like terms of the first equation, we can simplify to

2x - 8 = 180

If we add 8 to both sides, we get

2x = 188

And that means x = 94

If we substitute this into the second equation, we get

7(94) - 8 = ?

7 x 94 is equal to 658

658 - 8 = 650

2. Find the equation of the perpendicular bisector of line PQ where the co-ordinates of P and Q are P (-2, 8) and Q (4,7)

Answers

Answer:

2y - 12x = 3

Step-by-step explanation:

gradient of line PQ= (7-8)/ 4+2

-1/6

gradient of perpendicular bisector of line PQ=

-1 ÷ -1/6

-1× -6

6

coordinates of the midpoint of line PQ

(-2+4)/2, (8+7)/2

(1, 15/2)

the perpendicular bisector passes through the midpoint of line PQ

Equation of the perpendicular bisector

y - 15/2 = 6(x - 1)

multiply through by 2

2y - 15 = 12(x - 1)

2y - 15 = 12x - 12

2y - 12x = 3

-2 1/5 - 1 3/10 help!!

Answers

The answer would be -7/10

Translate the sentence into an equation using n as the unknown number. Then solve the equation for n.

5 increased by half a number is 11.

a.
5 + 0.5n = 11
n = 12
c.
5(0.5n) = 11

n = 4.4

b.
5n + 0.5 = 11
n = 2.1
d.
5n +0.5 = 11
n = 12



Please select the best answer from the choices provided


A
B
C
D

Answers

Answer:

the answer is A)5+0.5n=11

Step-by-step explanation:

5 is increased by half a number, so half of. a number(n) is added to 5

Answer:

D is correct

Step-by-step explanation:

I hope this helps

5 increased by half a number is 11.

5 increased by half a number is 11. 5 + 1/2n = 11 where n is the unknown number. 1/2n = 11 - 5 = 6 n = 6 * 2 = 12 The number is 12.

Use the distributive property to write an experssion that is equalent to 10+15x

Answers

Answer:

5(2+3x)

Step-by-step explanation:

5 x 2 = 10

5 x 3x = 15x

10+15x

(PEMDAS)

Answer:

Step-by-step explanation:

im a boy

How can you solve multistep equations that represent real world
scenarios?

Answers

Yeah like you can do scenarios or examples or you can get creative

Which of the following expressions is equal to the total investment of a no-load mutual fund?
a.
net assets ÷ number of shares
b.
net asset value ÷ number of shares
c.
net asset value x number of shares
d.
offer price x number of shares

Answer is C

Answers

If someone puts no job or social services on their rental application and yet they pay rent on time each month … they’re probably doing something illegal. Here in SoCal, if all they offer are 1099s as a “music producer” or other vague free lance type job, they might be dealers and you as the landlord are held to know that.

Answer:

C. net asset value x number of shares

Step-by-step explanation:

edge 2022

(x^2−x−6x^2−8x+16)/(x2−x−12)

What number cannot be the value of x in the expression above? Why?
Question 12 options:

Answers

-3 and 4 cannot be the values of x in the given expression

The expression is given as:

[tex]\frac{(x^2-x-6x^2-8x+16)}{(x^2-x-12)}[/tex]

Start by equating the denominator to 0

[tex]x^2 - x - 12 = 0[/tex]

Expand the above equation

[tex]x^2 - 4x + 3x - 12 = 0[/tex]

Factorize the equation

[tex]x(x - 4) + 3(x - 4) = 0[/tex]

Factor out x - 4

[tex](x + 3) (x - 4) = 0[/tex]

Split

[tex](x + 3)= 0\ or\ (x - 4) = 0[/tex]

Remove brackets

[tex]x + 3= 0\ or\ x - 4 = 0[/tex]

Solve for x

[tex]x =- 3\ or\ x = 4[/tex]

Hence, -3 and 4 cannot be the value of x in the given expression

Read more about expressions at:

https://brainly.com/question/2972832

Order the numbers from least to greatest

Answers

Step-by-step explanation:

(|  |) makes the number opposite

|10|=-10

|-3|=3

|0|=0

|-5.25|=5.25

Least to greatest

|10|, |0|, |3|, |5.25|

Let me know if there's any mistakes

Find the missing number of each unit rate.

20/4=?/1
10/15=?/1

Answers

Answer:

Step-by-step explanation:

divide 20 by four

20/4=5/1

now 10 and 15 can both be divided by 5 since 5 is the greatest common factor

10/15=2/3

Answer:

5 for the first 2/3 for the second

Step-by-step explanation:

just divide the numerator by what ever makes the denominator 1

4/4=1 so divide 20 by 4 which is 5

15/15 = 1 so 10/15 is 2/3

Rewrite each equation in exponential form:
log4(q) = m

Answers

[tex]\textit{exponential form of a logarithm} \\\\ \log_a(b)=y \qquad \implies \qquad a^y= b \\\\[-0.35em] ~\dotfill\\\\ \log_4(q)=m\implies 4^m = q[/tex]

Help help help math math math

Answers

Answer:

non-linear

Step-by-step explanation:

The function is non-linear because it does not follow a specific line, rather it curves. A linear function must have a stable slope throughout the relation.

The answer is non-linear. Hope this helps :)

Today, both the soccer team and the basketball tear
had games. The soccer team plays every 3 days and the
basketball team plays every 5 days. When will both
teams have games on the same day again?


SHOW YOUR WORK PLEASE

Answers

On the 15th day

Explanation

You have to find which multiple they have the same and that would be 15

3: 3, 6, 9, 12, 15, 18, 21 and so on
5: 5, 10, 15, 20, 25 and so on

Answer:3 to 5

Step-by-step explanation:i took the quiz

which inequality matches the graph?

A. x>4
B. x<4
C. x=4
D. x >4​

Answers

Answer:

B

Step-by-step explanation:

The line goes left which means its going to be less than 4.

Answer:

[B] x < 4

Step-by-step explanation:

First you must know the following:

> ⇒ greater than

< ⇒ less than

≥ ⇒ greater than or equal to

≤ ⇒ less than or equal to

= ⇒ equal

When going to the left it means less than

Thus, we can conclude that

x < 4

Kavinsky

How do you write 1.75 trillion, 1.75 quadrillion

Answers

Answer:

1) 1750000000000

2) 1750000000000000

Step-by-step explanation:

For definition of trillion and quadrillion.

Which equation represents this line in point-slope form?

A.
`(y + 4) = (4)/(3) (x + 3)`

B.
`(y −4) = -(4)/(3) (x +3)`

C.
`y= -(3)/(4)x`

D.
`4y− 3x = 0`

Answers

Answer:

The Answer is Option A or Option B

Step-by-step explanation:

First let's review what point slope form is.

[tex]y - y 1 = m(x - x1)[/tex]

To take a line and put it into point slope form you need to identify one of the points. In this case the point is either (-3, -4) or (-3, 4) but without a graph attached I cannot personally say which one it is.

You will also need to identify the slope of the line (m) based on the graph, so identify if the graph is ascending or descending. This alone can determine your answer

Again, there is no graph provided so it is up to you to determine if it is Option A or B.

I really hope this helps and you have a great rest of your day!

Note: I am not a professional educator so take my opinion carefully.

=)

LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor )

Answers

k=2
(kx,ky)
Therefore just multiply each coordinate by the scale factor --> 2

Answer:

A (2,2) B (4, -2) C (-4,0)

Step-by-step explanation:

K = 2

K is the scale factor so the y and x distance between the points will double

just take to coordinates and multiply them by 2

A 1,1 new 2,2

B 2, -1 new 4,-2

C -2,0 new -4,0

simplify\:\frac{\sqrt{5}}{\sqrt{3}}

Answers

[tex]\dfrac{\sqrt 5}{\sqrt 3} =\sqrt{\dfrac 53} \approx 1.291[/tex]

plss help me....... ​

Answers

Answer:

The slope

Step-by-step explanation:

Someone please help me!

Answers

y is 15 and x is 34, i hope that helped

help me out guys !!!!!!​

Answers

Answer:

[tex]2\sqrt[3]{5}[/tex]

Step-by-step explanation:

40 = 8 x 5 and 8 is the cube of 2, so 2 goes on the outside but 5 can't be simplified

The backyard of a new home is shaped like a trapezoid with a height of 44 nt and bases of 86ft and 106ft What is the cost of putting sod on the yard, if the
landscaper charges $0.25 por square foot for sod?

Answers

Answer:

Step-by-step explanation:

Area of a trapezoid is the average length of the bases times the height

C = A(0.25)

A = ½(86 + 106)(44) = 4224 ft²

C = 4224(0.25) = $1056.00

Your family has a total of 60 t-shirts and you decide to give some away. If 4 of the t-shirts are being worn right now, and there are 25 t-shirts left in the family's closets, how many t-shirts did your family give away?

Answers

You gave away 35 shirts. 60-25=35.

31

If you had 60 t-shirts and wore 4 and had 25 you do 25+4=29 then you do 60-29 that =31 so you will have sold 31 t-shirts

Please help solve this

Answers

Answer:

LCD= x²- 81

Step-by-step explanation:

x²-81 is difference of two squares

a²-b²= (a+b)(a-b)

x²- 81= (x+9)(x-9)

denominators, (x-9) and (x+9)(x-9)

x-9 is common in both denominators

x-9|(x-9)|(x+9)(x-9)

x+9| 1 | x+9

| 1 | 1

therefore the LCD= (x-9)(x+9)

simplifying= x²- 81

I’m pretty sure the answer would be81

ricky is a hardworking man who owns 6 hectares of land. in his will,he divided his lot equally among 7 sons. how much land will each of his son receive?
a. 0.68
b. 0.86
c. 68
d. 86 ​

Answers

Question:-

ricky is a hardworking man who owns 6 hectares of land. in his will,he divided his lot equally among 7 sons. how much land will each of his son receive?

a. 0.68

b. 0.86

c. 68

d. 86

Answer:-

Given,

Land owned by Ricky = 6 hectares

No. of sons = 7

Now,

6 ÷ 7 = 0.8571429 or 0.86

Each son will own 0.86 hectares of land. Option b. 0.86 is the answer.

Please due today by 10:00

Answers

what do you need help with?
C. [tex] \frac{6}{5} = 1 \ \frac{1}{5} \: or \: 1 \ \frac{3}{3} \\ [/tex]d.[tex]1 \ \frac{1}{4} = \frac{5}{4} \\ [/tex]

Find the values of the variables.
isosceles trapezoid
Side measures are: 4, 2x, 2x + 2 and 4x +3
X=

Answers

Answer:

x = 1

Step-by-step explanation:

Given isosceles trapezoid.

Its congruent sides are 4 and (2x + 2):

2x + 2 = 4

Solve for x:

2x = 2x = 1
Other Questions
A, who travels 4 miles an hour starts from a certain place 2 hours in advance of B, who travels 5miles an hour in the same direction. How many hours must B travel to overtake A? You can change the ____ or position of text within a document's margins. a. fielding b. proportion c. location d. alignment sixty students at gillette road middle school play a winter modified sport. if there are 500 students in the middle school, what percent of students play a sport 6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. Put these numbers in order from least to greatest.-12/40 -5 19/38 See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President I NEED MORE HELP PLZZ